Construct: ORF TRCN0000466889
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017003.1_s317c1
- Derived from:
- ccsbBroadEn_04148
- DNA Barcode:
- ACTACAACCCTCCGACTTTGTTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MRM1 (79922)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466889
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | NM_024864.5 | 100% | 100% | |
| 2 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | XM_017025112.2 | 88.4% | 85% | (many diffs) |
| 3 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | XM_011525275.3 | 87.9% | 83.3% | (many diffs) |
| 4 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | XM_011525276.3 | 87.9% | 83.3% | (many diffs) |
| 5 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | XM_005257694.5 | 60.5% | 60.3% | (many diffs) |
| 6 | human | 79922 | MRM1 | mitochondrial rRNA methyltr... | XR_934554.2 | 34.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1125
- ORF length:
- 1059
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc attgctctcg accgtccggg gcgcgacctg gggtcgcctc gtcacccgtc 121 atttctccca tgcagcgcgg catggggagc ggcctggtgg ggaggagcta agccgcttgc 181 tgctggatga cctggtgccg acctctcggc tggagcttct gtttggcatg accccgtgtc 241 tcctggctct gcaggccgcc cgccgctctg tggcccggct cctgctccag gcgggtaaag 301 ctgggctgca ggggaagcgg gccgagctgc tccggatggc cgaggcgcgg gacattccag 361 ttctgcggcc cagacggcag aaactggaca caatgtgccg ctaccaggtc caccagggtg 421 tctgcatgga ggtgagcccg ctgcggcccc ggccttggag agaggccggg gaggcgagcc 481 caggcgacga cccccagcag ttgtggctcg tcctcgatgg gatccaggat ccccggaatt 541 ttggggctgt gctgcgttcc gcacacttcc tcggagtgga taaggtcatc accagccgga 601 gaaacagctg cccgctcact ccagtagtca gcaagtccag cgcgggggct atggaggtga 661 tggacgtgtt ctccactgat gacctcaccg gatttttaca gaccaaagcc cagcagggct 721 ggctcgtggc cggcacggtg ggctgcccaa gcacagagga tccccagtcc tccgagatcc 781 ccatcatgag ttgcttggag ttcctctggg aacggcctac tctccttgtg ctggggaatg 841 agggctcagg tctatcccag gaggtgcagg cctcctgcca gcttctcctc accatcctgc 901 cccggcgcca gctgccTCCT GGACTTGAGT CCTTGAACGT CTCTGTGGCT GCAGGAATTC 961 TTCTTCACTC CATTTGCAGC CAGAGGAAGG GTTTCCCCAC AGAGGGGGAG AGAAGGCAGC 1021 TTCTCCAAGA CCCCCAAGAA CCCTCAGCCA GGTCTGAAGG GCTCAGCATG GCTCAGCACC 1081 CAGGGCTGTC TTCAGGCCCA GAGAAAGAGA GGCAAAATGA GGGCTGCCCA ACTTTCTTGT 1141 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1201 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1261 GAAAGGACGA ACTACAACCC TCCGACTTTG TTGCACGCGT TAAGTCgaca atcaacctct 1321 ggattacaaa atttgtgaaa gatt