Transcript: Human XM_011525276.3

PREDICTED: Homo sapiens mitochondrial rRNA methyltransferase 1 (MRM1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRM1 (79922)
Length:
2018
CDS:
229..1212

Additional Resources:

NCBI RefSeq record:
XM_011525276.3
NBCI Gene record:
MRM1 (79922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154347 CTTGAGTCCTTGAACGTCTCT pLKO.1 1087 CDS 100% 2.640 3.696 N MRM1 n/a
2 TRCN0000276347 CTTGAGTCCTTGAACGTCTCT pLKO_005 1087 CDS 100% 2.640 3.696 N MRM1 n/a
3 TRCN0000276345 ACACTTCCTCGGAGTGGATAA pLKO_005 726 CDS 100% 10.800 7.560 N MRM1 n/a
4 TRCN0000276346 ACTGATGACCTCACCGGATTT pLKO_005 838 CDS 100% 10.800 7.560 N MRM1 n/a
5 TRCN0000178929 CATCATGAGTTGCTTGGAGTT pLKO.1 945 CDS 100% 4.050 2.835 N MRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04148 pDONR223 100% 87.9% 83.3% None (many diffs) n/a
2 ccsbBroad304_04148 pLX_304 0% 87.9% 83.3% V5 (many diffs) n/a
3 TRCN0000466889 ACTACAACCCTCCGACTTTGTTGC pLX_317 20.2% 87.9% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_15995 pDONR223 0% 32.8% 28.3% None (many diffs) n/a
5 ccsbBroad304_15995 pLX_304 0% 32.8% 28.3% V5 (many diffs) n/a
6 TRCN0000481350 CTAGCGAACAACCGTCGCTTTAAT pLX_317 100% 32.8% 28.3% V5 (many diffs) n/a
Download CSV