Construct: ORF TRCN0000466998
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000046.1_s317c1
- Derived from:
- ccsbBroadEn_00177
- DNA Barcode:
- CCAAACTCTCTTCACTCATTACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BTD (686)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466998
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 686 | BTD | biotinidase | NM_001281723.3 | 96.3% | 96.3% | 0_1ins60 |
| 2 | human | 686 | BTD | biotinidase | NM_001281724.3 | 96.3% | 96.3% | 0_1ins60 |
| 3 | human | 686 | BTD | biotinidase | NM_001281725.2 | 96.3% | 96.3% | 0_1ins60 |
| 4 | human | 686 | BTD | biotinidase | NM_001323582.1 | 96.3% | 96.3% | 0_1ins60 |
| 5 | human | 686 | BTD | biotinidase | NM_001370658.1 | 96.3% | 96.3% | 0_1ins60 |
| 6 | human | 686 | BTD | biotinidase | XM_011534041.2 | 96.3% | 96.3% | 0_1ins60 |
| 7 | human | 686 | BTD | biotinidase | XM_017007088.1 | 96.3% | 96.3% | 0_1ins60 |
| 8 | human | 686 | BTD | biotinidase | XM_024453724.1 | 96.3% | 96.3% | 0_1ins60 |
| 9 | human | 686 | BTD | biotinidase | NM_001370752.1 | 65.7% | 62.6% | (many diffs) |
| 10 | human | 686 | BTD | biotinidase | NM_001281726.1 | 31.1% | 29.5% | (many diffs) |
| 11 | human | 686 | BTD | biotinidase | NM_001370753.1 | 25.5% | 24.8% | (many diffs) |
| 12 | mouse | 26363 | Btd | biotinidase | XM_006519029.3 | 63.9% | 65.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1695
- ORF length:
- 1629
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gcatgcgcat attcagggcg gaaggcgcgc taagagcaga tttgtggtct 121 gcattatgtc tggagccaga agtaagcttg ctcttttcct ctgcggctgt tacgtggttg 181 ccctgggagc ccacaccggg gaggagagcg tggctgacca tcacgaggct gaatattatg 241 tggctgccgt gtatgagcat ccatccatcc tgagtctgaa ccctctggct ctcatcagcc 301 gccaagaggc cttggagctc atgaaccaga accttgacat ctatgaacag caagtgatga 361 ctgcagccca aaaggatgta cagattatag tgtttccaga agatggcatt catggattca 421 actttacaag aacatccatt tatccatttt tggacttcat gccgtctccc caggtggtca 481 ggtggaaccc atgcctggag cctcaccgct tcaatgacac agaggtgctc cagcgcctga 541 gttgtatggc catcagggga gatatgttct tggtggccaa tcttgggaca aaggagcctt 601 gtcatagcag tgacccaagg tgcccaaaag atgggagata ccagttcaac acaaatgtcg 661 tgttcagcaa taatggaacc cttgttgacc gctaccgtaa acacaacctc tactttgagg 721 cagcattcga tgttcctctt aaagtggatc tcatcacctt tgataccccc tttgctggca 781 ggtttggcat cttcacatgc tttgatatat tgttctttga ccctgccatc agagtcctca 841 gagactacaa ggtgaagcat gttgtgtacc caactgcctg gatgaaccag ctcccactct 901 tggcagcaat tgagattcag aaagcttttg ctgttgcctt tggcatcaac gttctggcag 961 ctaatgtcca ccacccagtt ctggggatga caggaagtgg catacacacc cctctggagt 1021 ccttttggta ccatgacatg gaaaatccca aaagtcacct tataattgcc caggtggcca 1081 aaaatccagt gggtctcatt ggtgcagaga atgcaacagg tgaaacggac ccatcccata 1141 gtaagttttt aaaaattttg tcaggcgatc cgtactgtga gaaggatgct caggaagtcc 1201 actgtgatga ggccaccaag tggaacgtga atgctcctcc cacatttcac tctgagatga 1261 tgtatgacaa tttcaccctg gtccctgtct ggGGAAAGGA AGGCTATCTC CACGTCTGTT 1321 CCAATGGCCT CTGCTGTTAT TTACTTTACG AGAGGCCCAC CTTATCCAAA GAGCTGTATG 1381 CCCTGGGGGT CTTTGATGGG CTTCACACAG TACATGGCAC TTACTACATC CAAGTGTGTG 1441 CCCTGGTCAG GTGTGGGGGT CTTGGCTTCG ACACCTGTGG ACAGGAAATC ACAGAGGCCA 1501 CGGGGATATT TGAGTTTCAC CTGTGGGGCA ACTTCAGTAC TTCCTATATC TTTCCTTTGT 1561 TTCTGACCTC AGGGATGACC CTAGAAGTCC CTGACCAGCT TGGCTGGGAG AATGACCACT 1621 ATTTCCTGAG GAAAAGTAGG CTGTCCTCTG GGCTGGTGAC GGCGGCTCTC TATGGGCGCT 1681 TGTATGAGAG GGACTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1741 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1801 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCAAACTCTC TTCACTCATT 1861 ACTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt