Transcript: Human XM_011534041.2

PREDICTED: Homo sapiens biotinidase (BTD), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTD (686)
Length:
10076
CDS:
284..1855

Additional Resources:

NCBI RefSeq record:
XM_011534041.2
NBCI Gene record:
BTD (686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371377 ACGGACCCATCCCATAGTAAG pLKO_005 1283 CDS 100% 10.800 15.120 N BTD n/a
2 TRCN0000371437 CTTGTTGACCGCTACCGTAAA pLKO_005 839 CDS 100% 10.800 8.640 N BTD n/a
3 TRCN0000083026 CCTCTGCTGTTATTTACTTTA pLKO.1 1486 CDS 100% 13.200 9.240 N BTD n/a
4 TRCN0000371438 GCATTCATGGATTCAACTTTA pLKO_005 564 CDS 100% 13.200 9.240 N BTD n/a
5 TRCN0000083023 GCTGGGAGAATGACCACTATT pLKO.1 1761 CDS 100% 13.200 9.240 N BTD n/a
6 TRCN0000083024 CCTCTACTTTGAGGCAGCATT pLKO.1 865 CDS 100% 4.950 3.465 N BTD n/a
7 TRCN0000083025 GCAGCAATTGAGATTCAGAAA pLKO.1 1061 CDS 100% 4.950 3.465 N BTD n/a
8 TRCN0000083027 GCCAGAAGTAAGCTTGCTCTT pLKO.1 293 CDS 100% 4.050 2.835 N BTD n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8433 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7321 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000101408 CCTGAGTTGTATGGCCATCAA pLKO.1 694 CDS 100% 4.950 6.930 N Btd n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8434 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7392 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7392 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00177 pDONR223 100% 96.3% 96.3% None 0_1ins60 n/a
2 ccsbBroad304_00177 pLX_304 0% 96.3% 96.3% V5 0_1ins60 n/a
3 TRCN0000466998 CCAAACTCTCTTCACTCATTACTC pLX_317 25% 96.3% 96.3% V5 0_1ins60 n/a
Download CSV