Transcript: Mouse XM_006519029.3

PREDICTED: Mus musculus biotinidase (Btd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Btd (26363)
Length:
1715
CDS:
193..1431

Additional Resources:

NCBI RefSeq record:
XM_006519029.3
NBCI Gene record:
Btd (26363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348403 GTATCCACGGATTCAACTTTA pLKO_005 140 5UTR 100% 13.200 18.480 N Btd n/a
2 TRCN0000101409 GCAGATTATAGTGTTCCCAGA pLKO.1 114 5UTR 100% 2.160 3.024 N Btd n/a
3 TRCN0000334976 GCAGATTATAGTGTTCCCAGA pLKO_005 114 5UTR 100% 2.160 3.024 N Btd n/a
4 TRCN0000348480 AGGACGGGAGATACCAGTTTA pLKO_005 362 CDS 100% 13.200 9.240 N Btd n/a
5 TRCN0000083023 GCTGGGAGAATGACCACTATT pLKO.1 1337 CDS 100% 13.200 9.240 N BTD n/a
6 TRCN0000374790 ATGTGGTGTTCAGCGACAATG pLKO_005 389 CDS 100% 10.800 7.560 N Btd n/a
7 TRCN0000374857 CACTTGCTTTGACATCCTATT pLKO_005 528 CDS 100% 10.800 7.560 N Btd n/a
8 TRCN0000101407 CGTAAGCACAACCTGTACTTT pLKO.1 430 CDS 100% 5.625 3.938 N Btd n/a
9 TRCN0000101408 CCTGAGTTGTATGGCCATCAA pLKO.1 270 CDS 100% 4.950 3.465 N Btd n/a
10 TRCN0000101406 GCACTTTGTATATCTTTCCTT pLKO.1 1271 CDS 100% 3.000 2.100 N Btd n/a
11 TRCN0000348479 TGCTGGGAAAGCCACCCTTGT pLKO_005 1498 3UTR 100% 1.350 0.945 N Btd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00177 pDONR223 100% 63.9% 65.7% None (many diffs) n/a
2 ccsbBroad304_00177 pLX_304 0% 63.9% 65.7% V5 (many diffs) n/a
3 TRCN0000466998 CCAAACTCTCTTCACTCATTACTC pLX_317 25% 63.9% 65.7% V5 (many diffs) n/a
Download CSV