Construct: ORF TRCN0000467021
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001872.1_s317c1
- Derived from:
- ccsbBroadEn_10747
- DNA Barcode:
- GAGAAGGTCCATTGGGGCTGACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPT1B (1375)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467021
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_001145134.2 | 76.7% | 76.6% | 1_507del;1471_1476delCAGTGC;1489G>A |
| 2 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_001145135.2 | 73.4% | 73.3% | 1_609del;1573_1578delCAGTGC;1591G>A |
| 3 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_001145137.2 | 73.4% | 73.3% | 1_609del;1573_1578delCAGTGC;1591G>A |
| 4 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_004377.4 | 73.4% | 73.3% | 1_609del;1573_1578delCAGTGC;1591G>A |
| 5 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_152245.3 | 73.4% | 73.3% | 1_609del;1573_1578delCAGTGC;1591G>A |
| 6 | human | 1375 | CPT1B | carnitine palmitoyltransfer... | NM_152246.3 | 73.4% | 73.3% | 1_609del;1573_1578delCAGTGC;1591G>A |
| 7 | human | 386593 | CHKB-CPT1B | CHKB-CPT1B readthrough (NMD... | NR_027928.2 | 39.4% | (many diffs) | |
| 8 | mouse | 12895 | Cpt1b | carnitine palmitoyltransfer... | NM_009948.2 | 62.9% | 64.3% | (many diffs) |
| 9 | mouse | 100134861 | Gm44502 | predicted readthrough trans... | NR_004843.2 | 29.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1770
- ORF length:
- 1701
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagttgctg gccaaagaat tccaggacaa gactgccccc aggctgcaga 121 aatacctggt gctcaagtca tggtgggcaa gtaactatgt gagtgactgg tgggaagagt 181 acatctacct tcgaggcagg agccctctca tggtgaacag caactattat gtcatggacc 241 ttgtgctcat caagaataca gacgtgcagg cagcccgcct gggaaacatc atccacgcca 301 tgatcatgta tcgccgtaaa ctggaccgtg aagaaatcaa gcctgtgatg gcactgggca 361 tagtgcctat gtgctcctac cagatggaga ggatgttcaa caccactcgg atcccgggca 421 aggacacaga tgtgctacag cacctctcag acagccggca cgtggctgtc taccacaagg 481 gacgcttctt caagctgtgg ctctatgagg gcgcccgtct gctcaagcct caggatctgg 541 agatgcagtt ccagaggatc ctggacgacc cctccccacc tcagcctggg gaggagaagc 601 tggcagccct cactgcagga ggaagggtgg agtgggcgca ggcacgccag gccttcttta 661 gctctggaaa gaataaggct gccttggagg ccatcgagcg tgccgctttc ttcgtggccc 721 tggatgagga atcctactcc tatgaccccg aagatgaggc cagcctcagc ctctatggca 781 aggccctgct acatggcaac tgctacaaca ggtggtttga caaatccttc actctcattt 841 ccttcaagaa tggccagttg ggtctcaatg cagagcatgc gtgggcagat gctcccatca 901 ttgggcacct ctgggagttt gtcctgggca cagacagctt ccacctgggc tacacggaga 961 ccgggcactg cctgggcaaa ccgaaccctg cgctcgcacc tcctacacgg ctgcagtggg 1021 acattccaaa acaggcggtc atcaagagtt cctaccaggt ggccaaggcg ttggcagacg 1081 acgtggagtt gtactgcttc cagttcctgc cctttggcaa aggcctcatc aagaagtgcc 1141 ggaccagccc tgatgccttt gtgcagatcg cgctgcagct ggctcacttc cgggacaggg 1201 gtaagttctg cctgacctat gaggcctcaa tgaccagaat gttccgggag ggacggactg 1261 agactgtgcg ttcctgtacc agcgagtcca cagcctttgt gcaggccatg atggaggggt 1321 cccacacaaa agcagacctg cgagatctct tccagaaggc tgctaagaag caccagaata 1381 tgtaccgcct ggccatgacc ggggcaggga tcgacaggca cctcttctgc ctttacttgg 1441 tctccaagta cctaggagtc agctctcctt tccttgcTGA GGTGCTCTCG GAACCCTGGC 1501 GTCTCTCCAC CAGCCAGATC CCCCAATCCC AGATCCGCAT GTTCGACCCA GAGCAGCACC 1561 CCAATCACCT GGGCGCTGGA GGTGGCTTTG GCCCTGTAGC AGATGATGGC TATGGAGTTT 1621 CCTACATGAT TGCAGGCGAG AACACGATCT TCTTCCACAT CTCCAGCAAG TTCTCAAGCT 1681 CAGAGACGAA CGCCCAGCGC TTTGGAAACC ACATCCGCAA AGCCCTGCTG GACATTGCTG 1741 ATCTTTTCCA AGTTCCCAAG GCCTACAGCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1801 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1861 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGAGAA 1921 GGTCCATTGG GGCTGACTCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1981 tgaaagatt