Transcript: Human NM_152246.3

Homo sapiens carnitine palmitoyltransferase 1B (CPT1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CPT1B (1375)
Length:
2603
CDS:
62..2380

Additional Resources:

NCBI RefSeq record:
NM_152246.3
NBCI Gene record:
CPT1B (1375)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036318 CCAGATGGAGAGGATGTTCAA pLKO.1 982 CDS 100% 4.950 2.475 Y CPT1B n/a
2 TRCN0000036316 GCTATGTGTATCCGCCTTCTA pLKO.1 518 CDS 100% 4.950 2.475 Y CPT1B n/a
3 TRCN0000036315 GCTGCTAAGAAGCACCAGAAT pLKO.1 1967 CDS 100% 4.950 2.475 Y CPT1B n/a
4 TRCN0000036317 CCTGTAGCAGATGATGGCTAT pLKO.1 2201 CDS 100% 4.050 2.025 Y CPT1B n/a
5 TRCN0000036314 AGCCCTTAGGTACCTGTGTTT pLKO.1 2381 CDS 100% 0.000 0.000 Y CPT1B n/a
6 TRCN0000110547 GCACCTCTTCTGCCTTTACAT pLKO.1 2026 CDS 100% 5.625 2.813 Y Cpt1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06034 pDONR223 100% 99.9% 99.8% None 931A>G n/a
2 ccsbBroad304_06034 pLX_304 0% 99.9% 99.8% V5 931A>G n/a
3 TRCN0000474369 CATCCACTGCTGTACAACGAGACC pLX_317 12% 99.9% 99.8% V5 931A>G n/a
4 ccsbBroadEn_10747 pDONR223 100% 73.4% 73.3% None 1_609del;1573_1578delCAGTGC;1591G>A n/a
5 ccsbBroad304_10747 pLX_304 0% 73.4% 73.3% V5 1_609del;1573_1578delCAGTGC;1591G>A n/a
6 TRCN0000467021 GAGAAGGTCCATTGGGGCTGACTC pLX_317 17.5% 73.4% 73.3% V5 1_609del;1573_1578delCAGTGC;1591G>A n/a
Download CSV