Transcript: Mouse NM_009948.2

Mus musculus carnitine palmitoyltransferase 1b, muscle (Cpt1b), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Cpt1b (12895)
Length:
2894
CDS:
85..2403

Additional Resources:

NCBI RefSeq record:
NM_009948.2
NBCI Gene record:
Cpt1b (12895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036318 CCAGATGGAGAGGATGTTCAA pLKO.1 1005 CDS 100% 4.950 3.465 N CPT1B n/a
2 TRCN0000439841 CTCCATGGCAACTGCTATAAC pLKO_005 1414 CDS 100% 13.200 6.600 Y Cpt1b n/a
3 TRCN0000412939 GACAAATCTTTCACCCTTATC pLKO_005 1444 CDS 100% 10.800 5.400 Y Cpt1b n/a
4 TRCN0000110547 GCACCTCTTCTGCCTTTACAT pLKO.1 2049 CDS 100% 5.625 2.813 Y Cpt1b n/a
5 TRCN0000110546 CGGCCCTTATTGGATGATGAA pLKO.1 661 CDS 100% 4.950 2.475 Y Cpt1b n/a
6 TRCN0000110548 GCAACTATTATGCCATGGATT pLKO.1 845 CDS 100% 4.950 2.475 Y Cpt1b n/a
7 TRCN0000110545 ACTTGGCTGTTAGGTGCCTAT pLKO.1 2678 3UTR 100% 4.050 2.025 Y Cpt1b n/a
8 TRCN0000110549 GCCATCGAGAACTCGTACCAA pLKO.1 1669 CDS 100% 3.000 1.500 Y Cpt1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06034 pDONR223 100% 85.8% 86.9% None (many diffs) n/a
2 ccsbBroad304_06034 pLX_304 0% 85.8% 86.9% V5 (many diffs) n/a
3 TRCN0000474369 CATCCACTGCTGTACAACGAGACC pLX_317 12% 85.8% 86.9% V5 (many diffs) n/a
4 ccsbBroadEn_10747 pDONR223 100% 62.9% 64.3% None (many diffs) n/a
5 ccsbBroad304_10747 pLX_304 0% 62.9% 64.3% V5 (many diffs) n/a
6 TRCN0000467021 GAGAAGGTCCATTGGGGCTGACTC pLX_317 17.5% 62.9% 64.3% V5 (many diffs) n/a
Download CSV