Construct: ORF TRCN0000467060
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011619.1_s317c1
- Derived from:
- ccsbBroadEn_07585
- DNA Barcode:
- GCGGAGGTTCGGGACTCGTTCATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NMUR1 (10316)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467060
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10316 | NMUR1 | neuromedin U receptor 1 | NM_006056.5 | 99.9% | 99.7% | 608G>A |
| 2 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510487.3 | 94.5% | 94.3% | 0_1ins69;539G>A |
| 3 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712195.3 | 79.5% | 72.7% | (many diffs) |
| 4 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510488.2 | 77.4% | 70.8% | (many diffs) |
| 5 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_006712196.3 | 73.9% | 70.3% | (many diffs) |
| 6 | human | 10316 | NMUR1 | neuromedin U receptor 1 | XM_011510489.2 | 72.8% | 70.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1344
- ORF length:
- 1278
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tcctctctgc ctcaattgct ctgtcctccc tggagacctg tacccagggg 121 gtgcaaggaa ccccatggct tgcaatggca gtgcggccag ggggcacttt gaccctgagg 181 acttgaacct gactgacgag gcactgagac tcaagtacct ggggccccag cagacagagc 241 tgttcatgcc catctgtgcc acatacctgc tgatcttcgt ggtgggcgct gtgggcaatg 301 ggctgacctg tctggtcatc ctgcgccaca aggccatgcg cacgcctacc aactactacc 361 tcttcagcct ggccgtgtcg gacctgctgg tgctgctggt gggcctgccc ctggagctct 421 atgagatgtg gcacaactac cccttcctgc tgggcgttgg tggctgctat ttccgcacgc 481 tactgtttga gatggtctgc ctggcctcag tgctcaacgt cactgccctg agcgtggaac 541 gctatgtggc cgtggtgcac ccactccagg ccaggtccat ggtgacgcgg gcccatgtgc 601 gccgagtgct tggggccgtc tggggtcttg ccatgctctg ctccctgccc aacaccagcc 661 tgcacggcat ccagcagctg cacgtgccct gccggggccc agtgccagac tcagctgttt 721 gcatgctggt ccgcccacgg gccctctaca acatggtagt gcagaccacc gcgctgctct 781 tcttctgcct gcccatggcc atcatgagcg tgctctacct gctcattggg ctgcgactgc 841 ggcgggagag gctgctgctc atgcaggagg ccaagggcag gggctctgca gcagccaggt 901 ccagatacac cTGCAGGCTC CAGCAGCACG ATCGGGGCCG GAGACAAGTG ACCAAGATGC 961 TGTTTGTCCT GGTCGTGGTG TTTGGCATCT GCTGGGCCCC GTTCCACGCC GACCGCGTCA 1021 TGTGGAGCGT CGTGTCACAG TGGACAGATG GCCTGCACCT GGCCTTCCAG CACGTGCACG 1081 TCATCTCCGG CATCTTCTTC TACCTGGGCT CGGCGGCCAA CCCCGTGCTC TATAGCCTCA 1141 TGTCCAGCCG CTTCCGAGAG ACCTTCCAGG AGGCCCTGTG CCTCGGGGCC TGCTGCCATC 1201 GCCTCAGACC CCGCCACAGC TCCCACAGCC TCAGCAGGAT GACCACAGGC AGCACCCTGT 1261 GTGATGTGGG CTCCCTGGGC AGCTGGGTCC ACCCCCTGGC TGGGAACGAT GGCCCAGAGG 1321 CGCAGCAAGA GACCGATCCA TCCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CGGAGGTTCG 1501 GGACTCGTTC ATCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1561 att