Transcript: Human XM_011510489.2

PREDICTED: Homo sapiens neuromedin U receptor 1 (NMUR1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NMUR1 (10316)
Length:
3211
CDS:
85..1026

Additional Resources:

NCBI RefSeq record:
XM_011510489.2
NBCI Gene record:
NMUR1 (10316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004723 GCACGTCATCTCCGGCATCTT pLKO.1 2987 3UTR 100% 1.650 2.310 N NMUR1 n/a
2 TRCN0000004720 CCGGAGACAAGTGACCAAGAT pLKO.1 957 CDS 100% 4.950 3.960 N NMUR1 n/a
3 TRCN0000356356 ATGCCCATCTGTGCCACATAC pLKO_005 265 CDS 100% 10.800 7.560 N NMUR1 n/a
4 TRCN0000004722 CGCTACTGTTTGAGATGGTCT pLKO.1 497 CDS 100% 2.640 1.848 N NMUR1 n/a
5 TRCN0000004721 GCGCACGCCTACCAACTACTA pLKO.1 357 CDS 100% 1.650 1.155 N NMUR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491873 TGGGCAGGTCTAAACACGTTAGGA pLX_317 16.6% 72.9% 71.1% V5 (many diffs) n/a
2 TRCN0000488403 CCTAAAAGTGCTCTCAATCCGGAC pLX_317 20.8% 72.9% 71.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_07585 pDONR223 100% 72.8% 70.8% None (many diffs) n/a
4 ccsbBroad304_07585 pLX_304 0% 72.8% 70.8% V5 (many diffs) n/a
5 TRCN0000467060 GCGGAGGTTCGGGACTCGTTCATC pLX_317 34.1% 72.8% 70.8% V5 (many diffs) n/a
6 TRCN0000489112 CTCCCCTCTGAGCGAAGTTAGGGT pLX_317 21.9% 67.4% 65.4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488213 GCCCTTTATAACTTGGCCGAAAGT pLX_317 23.4% 67.3% 65.3% V5 (many diffs) n/a
Download CSV