Construct: ORF TRCN0000467102
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014452.1_s317c1
- Derived from:
- ccsbBroadEn_01748
- DNA Barcode:
- GCTCACCGGGGCTCCGTACAGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UFD1 (7353)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467102
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7353 | UFD1 | ubiquitin recognition facto... | NM_005659.7 | 100% | 100% | |
| 2 | human | 7353 | UFD1 | ubiquitin recognition facto... | NM_001362910.2 | 98.3% | 98.3% | 0_1insATGTTCTCTTTCAAC |
| 3 | human | 7353 | UFD1 | ubiquitin recognition facto... | NM_001035247.3 | 86.5% | 86.6% | 798_798delAins124 |
| 4 | mouse | 22230 | Ufd1 | ubiquitin recognition facto... | NM_011672.4 | 89.2% | 98.6% | (many diffs) |
| 5 | mouse | 22230 | Ufd1 | ubiquitin recognition facto... | XM_006522005.3 | 89.2% | 98.6% | (many diffs) |
| 6 | mouse | 22230 | Ufd1 | ubiquitin recognition facto... | XM_006522006.3 | 87.7% | 97% | (many diffs) |
| 7 | mouse | 22230 | Ufd1 | ubiquitin recognition facto... | XM_006522007.3 | 76% | 83.7% | (many diffs) |
| 8 | mouse | 22230 | Ufd1 | ubiquitin recognition facto... | NR_028403.1 | 39.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 987
- ORF length:
- 921
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ctctttcaac atgttcgacc accctattcc cagggtcttc caaaaccgct 121 tctccacaca gtaccgctgc ttctctgtgt ccatgctagc agggcctaat gacaggtcag 181 atgtggagaa aggagggaag ataattatgc caccctcggc cctggaccaa ctcagccgac 241 ttaacattac ctatcccatg ctgttcaaac tgaccaataa gaattcggac cgcatgacgc 301 attgtggcgt gctggagttt gtggctgatg agggcatctg ctacctccca cactggatga 361 tgcagaactt actcttggaa gaaggcggcc tggtccaggt ggagagcgtc aaccttcaag 421 tggccaccta ctccaaattc caacctcaga gccctgactt cctggacatc accaacccca 481 aagccgtatt agaaaacgca cttaggaact ttgcctgtct gaccaccggg gatgtgattg 541 ccatcaacta taatgaaaag atctacgaac tgcgtgtgat ggagaccaaa cccgacaagg 601 cagtgtccat cattgagtgt gacatgaacg tggactttga tgctcccctg ggctacaaag 661 aacccgaaag acaagtccag catgaggagt cgacagaagg tgaagccgac cacagtggct 721 atgctGGAGA GCTGGGCTTC CGCGCTTTCT CTGGATCTGG CAATAGACTG GATGGAAAGA 781 AGAAAGGGGT AGAGCCCAGC CCCTCCCCAA TCAAGCCTGG AGATATTAAA AGAGGAATTC 841 CCAATTATGA ATTTAAACTT GGTAAGATAA CTTTCATCAG AAATTCACGT CCCCTTGTCA 901 AAAAGGTTGA AGAGGATGAA GCTGGAGGCA GATTCGTCGC TTTCTCTGGA GAAGGACAGT 961 CATTGCGTAA AAAGGGAAGA AAGCCCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1021 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1081 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATCTTGTG GAAAGGACGA GCTCACCGGG 1141 GCTCCGTACA GTTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 1201 gatt