Transcript: Mouse XM_006522005.3

PREDICTED: Mus musculus ubiquitin fusion degradation 1 like (Ufd1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ufd1 (22230)
Length:
2072
CDS:
204..1127

Additional Resources:

NCBI RefSeq record:
XM_006522005.3
NBCI Gene record:
Ufd1 (22230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092224 GCTCAACATTACCTATCCTAT pLKO.1 377 CDS 100% 4.950 3.960 N Ufd1 n/a
2 TRCN0000325413 GCTCAACATTACCTATCCTAT pLKO_005 377 CDS 100% 4.950 3.960 N Ufd1 n/a
3 TRCN0000092225 CCACTGGATGATGCAGAATTT pLKO.1 488 CDS 100% 13.200 9.240 N Ufd1 n/a
4 TRCN0000325411 CCACTGGATGATGCAGAATTT pLKO_005 488 CDS 100% 13.200 9.240 N Ufd1 n/a
5 TRCN0000092227 GATGGAGACCAAACCTGACAA pLKO.1 716 CDS 100% 4.950 3.465 N Ufd1 n/a
6 TRCN0000325473 GATGGAGACCAAACCTGACAA pLKO_005 716 CDS 100% 4.950 3.465 N Ufd1 n/a
7 TRCN0000092226 GAGGAGTCAATAGAGGGAGAA pLKO.1 822 CDS 100% 4.050 2.835 N Ufd1 n/a
8 TRCN0000325410 GAGGAGTCAATAGAGGGAGAA pLKO_005 822 CDS 100% 4.050 2.835 N Ufd1 n/a
9 TRCN0000092223 GCCAGATATGAAAGGCAGAAT pLKO.1 1593 3UTR 100% 4.950 2.970 N Ufd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01748 pDONR223 100% 89.2% 98.6% None (many diffs) n/a
2 ccsbBroad304_01748 pLX_304 0% 89.2% 98.6% V5 (many diffs) n/a
3 TRCN0000467102 GCTCACCGGGGCTCCGTACAGTTT pLX_317 28.9% 89.2% 98.6% V5 (many diffs) n/a
Download CSV