Transcript: Human NM_001035247.3

Homo sapiens ubiquitin recognition factor in ER associated degradation 1 (UFD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
UFD1 (7353)
Length:
1738
CDS:
109..909

Additional Resources:

NCBI RefSeq record:
NM_001035247.3
NBCI Gene record:
UFD1 (7353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001035247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007488 CAGCCGACTTAACATTACCTA pLKO.1 276 CDS 100% 3.000 4.200 N UFD1 n/a
2 TRCN0000007489 CCCAATCAAGCCTGGAGATAT pLKO.1 849 CDS 100% 13.200 9.240 N UFD1 n/a
3 TRCN0000279805 CCCAATCAAGCCTGGAGATAT pLKO_005 849 CDS 100% 13.200 9.240 N UFD1 n/a
4 TRCN0000007485 GCTGTTCAAACTGACCAATAA pLKO.1 303 CDS 100% 13.200 9.240 N UFD1 n/a
5 TRCN0000279806 GCTGTTCAAACTGACCAATAA pLKO_005 303 CDS 100% 13.200 9.240 N UFD1 n/a
6 TRCN0000007487 TGGGCTACAAAGAACCCGAAA pLKO.1 692 CDS 100% 4.050 2.835 N UFD1 n/a
7 TRCN0000279737 TGGGCTACAAAGAACCCGAAA pLKO_005 692 CDS 100% 4.050 2.835 N UFD1 n/a
8 TRCN0000007486 CTGGCAATAGACTGGATGGAA pLKO.1 800 CDS 100% 3.000 2.100 N UFD1 n/a
9 TRCN0000279739 CTGGCAATAGACTGGATGGAA pLKO_005 800 CDS 100% 3.000 2.100 N UFD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01748 pDONR223 100% 86.5% 86.6% None 798_798delAins124 n/a
2 ccsbBroad304_01748 pLX_304 0% 86.5% 86.6% V5 798_798delAins124 n/a
3 TRCN0000467102 GCTCACCGGGGCTCCGTACAGTTT pLX_317 28.9% 86.5% 86.6% V5 798_798delAins124 n/a
Download CSV