Construct: ORF TRCN0000467201
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013349.1_s317c1
- Derived from:
- ccsbBroadEn_12768
- DNA Barcode:
- ACATTCACGGATTTCTCGACATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAGT1 (84061)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467201
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84061 | MAGT1 | magnesium transporter 1 | NM_001367916.1 | 100% | 100% | |
| 2 | human | 84061 | MAGT1 | magnesium transporter 1 | NM_032121.5 | 91.2% | 91.2% | 1_96del |
| 3 | mouse | 67075 | Magt1 | magnesium transporter 1 | NM_001190409.1 | 82.3% | 85.6% | (many diffs) |
| 4 | mouse | 67075 | Magt1 | magnesium transporter 1 | NM_025952.4 | 82.3% | 85.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcgcgttgg cggttttggt gtgtctctgt gaccatggtg gtggcgctgc 121 tcatcgtttg cgacgttccc tcagcctctg cccaaagaaa gaaggagatg gtgttatctg 181 aaaaggttag tcagctgatg gaatggacta acaaaagacc tgtaataaga atgaatggag 241 acaagttccg tcgccttgtg aaagccccac cgagaaatta ctccgttatc gtcatgttca 301 ctgctctcca actgcataga cagtgtgtcg tttgcaagca agctgatgaa gaattccaga 361 tcctggcaaa ctcctggcga tactccagtg cattcaccaa caggatattt tttgccatgg 421 tggattttga tgaaggctct gatgtatttc agatgctaaa catgaattca gctccaactt 481 tcatcaactt tcctgcaaaa gggaaaccca aacggggtga tacatatgag ttacaggtgc 541 ggggtttttc agctgagcag attgcccggt ggatcgccga cagaactgat gtcaatatta 601 gagtgattag acccccaaat tatgctggtc cccttatgtt gggattgctt ttggctgtta 661 ttggtggact tgtgtaTCTT CGAAGAAGTA ATATGGAATT TCTCTTTAAT AAAACTGGAT 721 GGGCTTTTGC AGCTTTGTGT TTTGTGCTTG CTATGACATC TGGTCAAATG TGGAACCATA 781 TAAGAGGACC ACCATATGCC CATAAGAATC CCCACACGGG ACATGTGAAT TATATCCATG 841 GAAGCAGTCA AGCCCAGTTT GTAGCTGAAA CACACATTGT TCTTCTGTTT AATGGTGGAG 901 TTACCTTAGG AATGGTGCTT TTATGTGAAG CTGCTACCTC TGACATGGAT ATTGGAAAGC 961 GAAAGATAAT GTGTGTGGCT GGTATTGGAC TTGTTGTATT ATTCTTCAGT TGGATGCTCT 1021 CTATTTTTAG ATCTAAATAT CATGGCTACC CATACAGCTT TCTGATGAGT TACCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGAACAT TCACGGATTT CTCGACATCA ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt