Transcript: Human NM_001367916.1

Homo sapiens magnesium transporter 1 (MAGT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MAGT1 (84061)
Length:
4506
CDS:
26..1033

Additional Resources:

NCBI RefSeq record:
NM_001367916.1
NBCI Gene record:
MAGT1 (84061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064386 CCGACAGAACTGATGTCAATA pLKO.1 537 CDS 100% 13.200 18.480 N MAGT1 n/a
2 TRCN0000333178 CCGACAGAACTGATGTCAATA pLKO_005 537 CDS 100% 13.200 18.480 N MAGT1 n/a
3 TRCN0000064384 GCTACCTCTGACATGGATATT pLKO.1 893 CDS 100% 13.200 18.480 N MAGT1 n/a
4 TRCN0000333179 GCTACCTCTGACATGGATATT pLKO_005 893 CDS 100% 13.200 18.480 N MAGT1 n/a
5 TRCN0000344731 ACCGAGAAATTACTCCGTTAT pLKO_005 229 CDS 100% 10.800 15.120 N MAGT1 n/a
6 TRCN0000064383 CCACCGAGAAATTACTCCGTT pLKO.1 227 CDS 100% 2.640 3.696 N MAGT1 n/a
7 TRCN0000344791 TGTATACTTTACGCATCTTTC pLKO_005 1501 3UTR 100% 10.800 7.560 N MAGT1 n/a
8 TRCN0000110313 GCTCCAACTTTCATCAACTTT pLKO.1 431 CDS 100% 5.625 3.938 N Magt1 n/a
9 TRCN0000302767 GCTCCAACTTTCATCAACTTT pLKO_005 431 CDS 100% 5.625 3.938 N Magt1 n/a
10 TRCN0000064385 GCTGATGGAATGGACTAACAA pLKO.1 154 CDS 100% 5.625 3.938 N MAGT1 n/a
11 TRCN0000064387 CCACCATATGCCCATAAGAAT pLKO.1 749 CDS 100% 0.000 0.000 N MAGT1 n/a
12 TRCN0000333260 CCACCATATGCCCATAAGAAT pLKO_005 749 CDS 100% 0.000 0.000 N MAGT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12768 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12768 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467201 ACATTCACGGATTTCTCGACATCA pLX_317 39.5% 100% 100% V5 n/a
4 ccsbBroadEn_12769 pDONR223 100% 39.7% 38.8% None (many diffs) n/a
5 ccsbBroad304_12769 pLX_304 0% 39.7% 38.8% V5 (many diffs) n/a
6 TRCN0000466839 GTTCCCTCCCGCACGTGCTCACCC pLX_317 78.6% 39.7% 38.8% V5 (many diffs) n/a
Download CSV