Construct: ORF TRCN0000467218
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001897.1_s317c1
- Derived from:
- ccsbBroadEn_02440
- DNA Barcode:
- GTGTCATGCCCCCCGTTTACCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPIE (10450)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467218
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_006112.4 | 100% | 100% | |
| 2 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_006710290.4 | 95.6% | 95.6% | 382_383ins39 |
| 3 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_203456.2 | 95.3% | 92.7% | (many diffs) |
| 4 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_001195007.1 | 91.5% | 89.7% | (many diffs) |
| 5 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_017000051.2 | 91.5% | 89.7% | (many diffs) |
| 6 | human | 10450 | PPIE | peptidylprolyl isomerase E | NM_001319293.1 | 91.1% | 88.4% | (many diffs) |
| 7 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_006710289.3 | 87.5% | 85.7% | (many diffs) |
| 8 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_017000052.1 | 72% | 72% | 0_1ins252 |
| 9 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450264.1 | 72% | 72% | 0_1ins252 |
| 10 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450277.1 | 67.7% | 65% | (many diffs) |
| 11 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_011540501.1 | 65.3% | 63.6% | (many diffs) |
| 12 | human | 10450 | PPIE | peptidylprolyl isomerase E | XM_024450252.1 | 65.3% | 63.6% | (many diffs) |
| 13 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946520.3 | 60.6% | (many diffs) | |
| 14 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946519.3 | 60.5% | 1_29del;411_412ins124;809_1162del | |
| 15 | human | 10450 | PPIE | peptidylprolyl isomerase E | XR_946521.3 | 26.3% | (many diffs) | |
| 16 | human | 10450 | PPIE | peptidylprolyl isomerase E | NR_036543.1 | 20.3% | 1_56del;79_80insGTACGTGG;952_4384del | |
| 17 | human | 10450 | PPIE | peptidylprolyl isomerase E | NR_036544.1 | 19.4% | (many diffs) | |
| 18 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | NM_019489.5 | 90.9% | 98.3% | (many diffs) |
| 19 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_006503249.3 | 70.9% | 76.4% | (many diffs) |
| 20 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_006503250.3 | 65.4% | 70.4% | (many diffs) |
| 21 | mouse | 56031 | Ppie | peptidylprolyl isomerase E ... | XM_011240581.1 | 65.4% | 70.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc caccaccaag cgcgtcttgt acgtgggtgg actggcagag gaagtggacg 121 acaaagttct tcatgctgcg ttcattcctt ttggagacat cacagatatt cagattcctc 181 tggattatga aacagaaaag caccgaggat ttgcttttgt tgaatttgag ttggcagagg 241 atgctgcagc agctatcgac aacatgaatg aatctgagct ttttggacgt acaattcgtg 301 tcaatttggc caaaccaatg agaattaagg aaggctcttc caggccagtt tggtcagatg 361 atgactggtt gaagaagttt tctgggaaga cgcttgaaga gaataaagag gaagaagggt 421 cagagcctcc caaagcagag acccaggagg gagagcccat tgctaaaaag gcccgctcaa 481 atcctcaggt gtacatggac atcaagattg ggaacaagcc ggctggccgc atccagatgc 541 tccTGCGTTC TGATGTCGTG CCCATGACAG CAGAGAATTT CCGCTGCCTG TGCACTCATG 601 AAAAGGGCTT TGGCTTTAAG GGAAGCAGCT TCCACCGCAT CATCCCCCAG TTCATGTGCC 661 AGGGCGGTGA TTTCACAAAC CACAATGGCA CTGGGGGCAA GTCCATCTAT GGGAAGAAGT 721 TCGATGATGA AAACTTTATC CTCAAGCATA CGGGACCAGG TCTACTATCC ATGGCCAACT 781 CTGGCCCAAA CACCAATGGC TCTCAGTTCT TCCTGACATG TGACAAGACA GACTGGCTGG 841 ATGGCAAGCA TGTGGTGTTT GGAGAGGTCA CCGAAGGCCT AGATGTCTTG CGGCAAATTG 901 AGGCCCAGGG CAGCAAGGAC GGGAAGCCAA AGCAGAAGGT GATCATCGCC GACTGTGGGG 961 AGTACGTGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGTGTCA TGCCCCCCGT TTACCGTTAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt