Transcript: Human XM_006710289.3

PREDICTED: Homo sapiens peptidylprolyl isomerase E (PPIE), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPIE (10450)
Length:
1188
CDS:
30..935

Additional Resources:

NCBI RefSeq record:
XM_006710289.3
NBCI Gene record:
PPIE (10450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049372 GACGTACAATTCGTGTCAATT pLKO.1 250 CDS 100% 13.200 18.480 N PPIE n/a
2 TRCN0000307111 GACGTACAATTCGTGTCAATT pLKO_005 250 CDS 100% 13.200 18.480 N PPIE n/a
3 TRCN0000049370 CCTAGATGTCTTGCGGCAAAT pLKO.1 803 CDS 100% 10.800 15.120 N PPIE n/a
4 TRCN0000307113 CCTAGATGTCTTGCGGCAAAT pLKO_005 803 CDS 100% 10.800 15.120 N PPIE n/a
5 TRCN0000049368 GCAGCTATCGACAACATGAAT pLKO.1 213 CDS 100% 5.625 7.875 N PPIE n/a
6 TRCN0000289622 GCAGCTATCGACAACATGAAT pLKO_005 213 CDS 100% 5.625 7.875 N PPIE n/a
7 TRCN0000101092 AGCAGCTATCGACAACATGAA pLKO.1 212 CDS 100% 4.950 3.465 N Ppie n/a
8 TRCN0000325122 AGCAGCTATCGACAACATGAA pLKO_005 212 CDS 100% 4.950 3.465 N Ppie n/a
9 TRCN0000049371 GTGGACGACAAAGTTCTTCAT pLKO.1 78 CDS 100% 4.950 3.465 N PPIE n/a
10 TRCN0000289684 GTGGACGACAAAGTTCTTCAT pLKO_005 78 CDS 100% 4.950 3.465 N PPIE n/a
11 TRCN0000049369 CGGTGATTTCACAAACCACAA pLKO.1 590 CDS 100% 4.050 2.430 N PPIE n/a
12 TRCN0000289683 CGGTGATTTCACAAACCACAA pLKO_005 590 CDS 100% 4.050 2.430 N PPIE n/a
13 TRCN0000049171 GATGGCAAGCATGTGGTGTTT pLKO.1 765 CDS 100% 4.950 2.475 Y PPIA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02440 pDONR223 100% 87.5% 85.7% None (many diffs) n/a
2 ccsbBroad304_02440 pLX_304 0% 87.5% 85.7% V5 (many diffs) n/a
3 TRCN0000467218 GTGTCATGCCCCCCGTTTACCGTT pLX_317 47.2% 87.5% 85.7% V5 (many diffs) n/a
4 TRCN0000488597 AGTGATGCTCCCCTCTCAGTTGCC pLX_317 36.9% 87.5% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491745 GCTGTCGCCCCGGAAGTGTCAAGC pLX_317 39.3% 87% 85.4% V5 (many diffs) n/a
Download CSV