Transcript: Mouse XM_006503250.3

PREDICTED: Mus musculus peptidylprolyl isomerase E (cyclophilin E) (Ppie), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppie (56031)
Length:
1262
CDS:
345..998

Additional Resources:

NCBI RefSeq record:
XM_006503250.3
NBCI Gene record:
Ppie (56031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101093 GACGGACGATTCGTGTCAATT pLKO.1 313 5UTR 100% 13.200 18.480 N Ppie n/a
2 TRCN0000325123 GACGGACGATTCGTGTCAATT pLKO_005 313 5UTR 100% 13.200 18.480 N Ppie n/a
3 TRCN0000101091 AGGTTCTTCATGCTGCATTTA pLKO.1 120 5UTR 100% 13.200 9.240 N Ppie n/a
4 TRCN0000354037 AGGTTCTTCATGCTGCATTTA pLKO_005 120 5UTR 100% 13.200 9.240 N Ppie n/a
5 TRCN0000101090 GTAGAGCACAAGCCTTTCCTT pLKO.1 1070 3UTR 100% 3.000 2.100 N Ppie n/a
6 TRCN0000325121 GTAGAGCACAAGCCTTTCCTT pLKO_005 1070 3UTR 100% 3.000 2.100 N Ppie n/a
7 TRCN0000101094 ACAAGGTTCTTCATGCTGCAT pLKO.1 117 5UTR 100% 2.640 1.848 N Ppie n/a
8 TRCN0000101092 AGCAGCTATCGACAACATGAA pLKO.1 244 5UTR 100% 4.950 3.465 N Ppie n/a
9 TRCN0000325122 AGCAGCTATCGACAACATGAA pLKO_005 244 5UTR 100% 4.950 3.465 N Ppie n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02440 pDONR223 100% 65.4% 70.4% None (many diffs) n/a
2 ccsbBroad304_02440 pLX_304 0% 65.4% 70.4% V5 (many diffs) n/a
3 TRCN0000467218 GTGTCATGCCCCCCGTTTACCGTT pLX_317 47.2% 65.4% 70.4% V5 (many diffs) n/a
4 TRCN0000488597 AGTGATGCTCCCCTCTCAGTTGCC pLX_317 36.9% 65.4% 70.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491745 GCTGTCGCCCCGGAAGTGTCAAGC pLX_317 39.3% 65.3% 70.1% V5 (many diffs) n/a
Download CSV