Construct: ORF TRCN0000467267
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004592.1_s317c1
- Derived from:
- ccsbBroadEn_00511
- DNA Barcode:
- GCATAGGTTTGACCGGCAAAGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CLN8 (2055)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467267
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | NM_018941.4 | 100% | 100% | |
2 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_005266021.4 | 100% | 100% | |
3 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_005266022.1 | 100% | 100% | |
4 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_005266023.1 | 100% | 100% | |
5 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_011534745.1 | 100% | 100% | |
6 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_011534746.2 | 100% | 100% | |
7 | human | 2055 | CLN8 | CLN8 transmembrane ER and E... | XM_011534747.2 | 71.5% | 58.5% | (many diffs) |
8 | mouse | 26889 | Cln8 | ceroid-lipofuscinosis, neur... | NM_012000.3 | 81.1% | 85% | (many diffs) |
9 | mouse | 26889 | Cln8 | ceroid-lipofuscinosis, neur... | XM_006508806.3 | 81.1% | 85% | (many diffs) |
10 | mouse | 26889 | Cln8 | ceroid-lipofuscinosis, neur... | XM_006508807.2 | 81.1% | 85% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 924
- ORF length:
- 858
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tcctgcgagc gatgggggca catcagagag catttttgac ctggactatg 121 catcctgggg gatccgctcc acgctgatgg tcgctggctt tgtcttctac ttgggcgtct 181 ttgtggtctg ccaccagctg tcctcttccc tgaatgccac ttaccgttct ttggtggcca 241 gagagaaggt cttctgggac ctggcggcca cgcgtgcagt ctttggtgtt cagagcacag 301 ccgcaggcct gtgggctctg ctgggggacc ctgtgctgca tgccgacaag gcgcgtggcc 361 agcagaactg gtgctggttt cacatcacga cagcaacggg attcttttgc tttgaaaatg 421 ttgcagtcca cctgtccaac ttgatcttcc ggacatttga cttgtttctg gttatccacc 481 atctctttgc ctttcttggg tttcttggct gcttggtcaa tctccaagct ggccactatc 541 tagctatgac cacgttgctc ctGGAGATGA GCACGCCCTT TACCTGCGTT TCCTGGATGC 601 TCTTAAAGGC GGGCTGGTCC GAGTCTCTGT TTTGGAAGCT CAACCAGTGG CTGATGATTC 661 ACATGTTTCA CTGCCGCATG GTTCTAACCT ACCACATGTG GTGGGTGTGT TTCTGGCACT 721 GGGACGGCCT GGTCAGCAGC CTGTATCTGC CTCATTTGAC ACTGTTCCTT GTCGGACTGG 781 CTCTGCTTAC GCTAATCATT AATCCATATT GGACCCATAA GAAGACTCAG CAGCTTCTCA 841 ATCCGGTGGA CTGGAACTTC GCACAGCCAG AAGCCAAGAG CAGGCCAGAA GGCAACGGGC 901 AGCTGCTGCG GAAGAAGAGG CCATACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 961 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1021 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG CATAGGTTTG 1081 ACCGGCAAAG ATCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1141 att