Transcript: Mouse XM_006508807.2

PREDICTED: Mus musculus ceroid-lipofuscinosis, neuronal 8 (Cln8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cln8 (26889)
Length:
2594
CDS:
643..1509

Additional Resources:

NCBI RefSeq record:
XM_006508807.2
NBCI Gene record:
Cln8 (26889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105004 CACCACCTCTTTGCCTTTCTT pLKO.1 1054 CDS 100% 5.625 3.938 N Cln8 n/a
2 TRCN0000325859 CACCACCTCTTTGCCTTTCTT pLKO_005 1054 CDS 100% 5.625 3.938 N Cln8 n/a
3 TRCN0000105002 CCCTTACTGGACACACAAGAA pLKO.1 1380 CDS 100% 4.950 3.465 N Cln8 n/a
4 TRCN0000325927 CCCTTACTGGACACACAAGAA pLKO_005 1380 CDS 100% 4.950 3.465 N Cln8 n/a
5 TRCN0000105001 CCAGTGGCTAATGATCCACAT pLKO.1 1221 CDS 100% 4.050 2.835 N Cln8 n/a
6 TRCN0000325860 CCAGTGGCTAATGATCCACAT pLKO_005 1221 CDS 100% 4.050 2.835 N Cln8 n/a
7 TRCN0000105003 CCCGTGCTCTATGCCGACAAA pLKO.1 907 CDS 100% 1.650 1.155 N Cln8 n/a
8 TRCN0000325928 CCCGTGCTCTATGCCGACAAA pLKO_005 907 CDS 100% 1.650 1.155 N Cln8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00511 pDONR223 100% 81.1% 85% None (many diffs) n/a
2 ccsbBroad304_00511 pLX_304 0% 81.1% 85% V5 (many diffs) n/a
3 TRCN0000467267 GCATAGGTTTGACCGGCAAAGATC pLX_317 42.3% 81.1% 85% V5 (many diffs) n/a
Download CSV