Transcript: Human XM_005266021.4

PREDICTED: Homo sapiens CLN8 transmembrane ER and ERGIC protein (CLN8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLN8 (2055)
Length:
1220
CDS:
160..1020

Additional Resources:

NCBI RefSeq record:
XM_005266021.4
NBCI Gene record:
CLN8 (2055)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266021.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430621 GGCTGATGATTCACATGTTTC pLKO_005 743 CDS 100% 10.800 15.120 N CLN8 n/a
2 TRCN0000422260 GTTTCCTGGATGCTCTTAAAG pLKO_005 682 CDS 100% 13.200 9.240 N CLN8 n/a
3 TRCN0000413309 TTGAAGTAGCTACAAAGTATT pLKO_005 1172 3UTR 100% 13.200 9.240 N CLN8 n/a
4 TRCN0000414062 ACTTGATCTTCCGGACATTTG pLKO_005 533 CDS 100% 10.800 7.560 N CLN8 n/a
5 TRCN0000063751 GAATGCCACTTACCGTTCTTT pLKO.1 306 CDS 100% 5.625 3.938 N CLN8 n/a
6 TRCN0000063748 GCTCTGCTTACGCTAATCATT pLKO.1 874 CDS 100% 5.625 3.938 N CLN8 n/a
7 TRCN0000063749 GTCTTCTACTTGGGCGTCTTT pLKO.1 256 CDS 100% 4.950 3.465 N CLN8 n/a
8 TRCN0000063750 CCTCATTTGACACTGTTCCTT pLKO.1 844 CDS 100% 3.000 2.100 N CLN8 n/a
9 TRCN0000063752 GCTGCGGAAGAAGAGGCCATA pLKO.1 999 CDS 100% 1.350 0.945 N CLN8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266021.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00511 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00511 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467267 GCATAGGTTTGACCGGCAAAGATC pLX_317 42.3% 100% 100% V5 n/a
Download CSV