Construct: ORF TRCN0000467373
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015649.1_s317c1
- Derived from:
- ccsbBroadEn_11968
- DNA Barcode:
- ATAACGGGACGGCTTATCCCTGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NT5C3A (51251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467373
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001002010.4 | 100% | 100% | |
| 2 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374335.1 | 90% | 90% | 137_138ins99 |
| 3 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001002009.3 | 86.4% | 86.4% | (many diffs) |
| 4 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_016489.13 | 86.4% | 86.4% | (many diffs) |
| 5 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001166118.3 | 86.1% | 86.1% | 0_1ins138 |
| 6 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001356996.2 | 86.1% | 86.1% | 0_1ins138 |
| 7 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374336.1 | 86.1% | 86.1% | 0_1ins138 |
| 8 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374337.1 | 86.1% | 86.1% | 0_1ins138 |
| 9 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374338.1 | 79.7% | 79.7% | 693_694ins201 |
| 10 | human | 51251 | NT5C3A | 5'-nucleotidase, cytosolic ... | NM_001374339.1 | 77.6% | 77.3% | (many diffs) |
| 11 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_026004.3 | 86.6% | 93.6% | (many diffs) |
| 12 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505274.2 | 75.9% | 80.6% | (many diffs) |
| 13 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505275.2 | 74.5% | 80.3% | (many diffs) |
| 14 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_001252374.1 | 74.3% | 80.4% | (many diffs) |
| 15 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | NM_001360963.1 | 74.3% | 80.4% | (many diffs) |
| 16 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505273.2 | 74.3% | 80.4% | (many diffs) |
| 17 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_011241111.2 | 74.3% | 80.4% | (many diffs) |
| 18 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_030255051.1 | 74.3% | 80.4% | (many diffs) |
| 19 | mouse | 107569 | Nt5c3 | 5'-nucleotidase, cytosolic III | XM_006505276.4 | 74.2% | 80% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1059
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccgcgcggcc gtggcgaggg tgggcgcggt agcgagcgcc agcgtgtgcg 121 ccctggtggc gggggtggtg ctggctcagt acatattcac cttgaagagg aagacggggc 181 ggaagaccaa gatcatcgag atgatgccag aattccagaa aagttcagtt cgaatcaaga 241 accctacaag agtagaagaa attatctgtg gtcttatcaa aggaggagct gccaaacttc 301 agataataac ggactttgat atgacactca gtagattttc atataaaggg aaaagatgcc 361 caacatgtca taatatcatt gacaactgta agctggttac agatgaatgt agaaaaaagt 421 tattgcaact aaaggaaaaa tattacgcta ttgaagttga tcctgttctt actgtagaag 481 agaagtaccc ttatatggtg gaatggtata ctaaatcaca tggtttgctt gttcagcaag 541 ctttaccaaa agctaaactt aaagaaattg tggcagaatc tgacgttatg ctcaaagaag 601 gatatgagaa tttctttgat aagctccaac aacatagcat ccccgtgttc atattttcgg 661 ctggaatcgg cgatgtacta gaggaagtta ttcgtcaagc tggtgtttat catcccaatg 721 tcaaagttgt gtccaatttt atggattttg atgaaactgg ggtgctcaaa ggatttaaag 781 gagaactaat tcatgtattt aacaaacatg atggtgcctt gaggaataca gaatatttca 841 aTCAACTAAA AGACAATAGT AACATAATTC TTCTGGGAGA CTCCCAAGGA GACTTAAGAA 901 TGGCAGATGG AGTGGCCAAT GTTGAGCACA TTCTGAAAAT TGGATATCTA AATGATAGAG 961 TGGATGAGCT TTTAGAAAAG TACATGGACT CTTATGATAT TGTTTTAGTA CAAGATGAAT 1021 CATTAGAAGT AGCCAACTCT ATTTTACAGA AGATTCTATA CCCAACTTTC TTGTACAAAG 1081 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1141 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1201 ACGAATAACG GGACGGCTTA TCCCTGAAAC GCGTTAAGTC gacaatcaac ctctggatta 1261 caaaatttgt gaaagatt