Transcript: Human NM_001002010.4

Homo sapiens 5'-nucleotidase, cytosolic IIIA (NT5C3A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
NT5C3A (51251)
Length:
1684
CDS:
72..1067

Additional Resources:

NCBI RefSeq record:
NM_001002010.4
NBCI Gene record:
NT5C3A (51251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002010.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020028 CATTAGAAGTAGCCAACTCTA pLKO.1 1027 CDS 100% 4.950 3.960 N NT5C3A n/a
2 TRCN0000432882 ATGGTGGAATGGTATACTAAA pLKO_005 501 CDS 100% 13.200 9.240 N NT5C3A n/a
3 TRCN0000020026 CCTACAAGAGTAGAAGAAATT pLKO.1 249 CDS 100% 13.200 9.240 N NT5C3A n/a
4 TRCN0000431012 GATATGACACTCAGTAGATTT pLKO_005 324 CDS 100% 13.200 9.240 N NT5C3A n/a
5 TRCN0000020025 GCCTTGAGGAATACAGAATAT pLKO.1 822 CDS 100% 13.200 9.240 N NT5C3A n/a
6 TRCN0000020024 GCGATGTACTAGAGGAAGTTA pLKO.1 676 CDS 100% 5.625 3.938 N NT5C3A n/a
7 TRCN0000020027 GCTGGTGTTTATCATCCCAAT pLKO.1 705 CDS 100% 4.050 2.835 N NT5C3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002010.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11968 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11968 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467373 ATAACGGGACGGCTTATCCCTGAA pLX_317 22.5% 100% 100% V5 n/a
4 ccsbBroadEn_08261 pDONR223 100% 86.3% 86.4% None 1_135del;378T>C n/a
5 ccsbBroad304_08261 pLX_304 0% 86.3% 86.4% V5 1_135del;378T>C n/a
6 TRCN0000472050 TCTACCTATGACCGTTGAGTTGCT pLX_317 24.6% 86.3% 86.4% V5 1_135del;378T>C n/a
Download CSV