Transcript: Mouse NM_026004.3

Mus musculus 5'-nucleotidase, cytosolic III (Nt5c3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Nt5c3 (107569)
Length:
1687
CDS:
124..1119

Additional Resources:

NCBI RefSeq record:
NM_026004.3
NBCI Gene record:
Nt5c3 (107569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191105 GAGAATTTCTTCGGTAAACTT pLKO.1 664 CDS 100% 5.625 7.875 N Nt5c3 n/a
2 TRCN0000292844 GAGAATTTCTTCGGTAAACTT pLKO_005 664 CDS 100% 5.625 7.875 N Nt5c3 n/a
3 TRCN0000201522 CGTTATGCTCAAGGAAGGATA pLKO.1 642 CDS 100% 4.950 6.930 N Nt5c3 n/a
4 TRCN0000292921 CGTTATGCTCAAGGAAGGATA pLKO_005 642 CDS 100% 4.950 6.930 N Nt5c3 n/a
5 TRCN0000020026 CCTACAAGAGTAGAAGAAATT pLKO.1 301 CDS 100% 13.200 9.240 N NT5C3A n/a
6 TRCN0000191047 CAAAGTAGTGTCAAACTTCAT pLKO.1 780 CDS 100% 4.950 3.465 N Nt5c3 n/a
7 TRCN0000292843 CAAAGTAGTGTCAAACTTCAT pLKO_005 780 CDS 100% 4.950 3.465 N Nt5c3 n/a
8 TRCN0000192367 CCTGAAGAATACAGACTACTT pLKO.1 876 CDS 100% 4.950 3.465 N Nt5c3 n/a
9 TRCN0000292846 CCTGAAGAATACAGACTACTT pLKO_005 876 CDS 100% 4.950 3.465 N Nt5c3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11968 pDONR223 100% 86.6% 93.6% None (many diffs) n/a
2 ccsbBroad304_11968 pLX_304 0% 86.6% 93.6% V5 (many diffs) n/a
3 TRCN0000467373 ATAACGGGACGGCTTATCCCTGAA pLX_317 22.5% 86.6% 93.6% V5 (many diffs) n/a
4 ccsbBroadEn_08261 pDONR223 100% 74.4% 80.3% None (many diffs) n/a
5 ccsbBroad304_08261 pLX_304 0% 74.4% 80.3% V5 (many diffs) n/a
6 TRCN0000472050 TCTACCTATGACCGTTGAGTTGCT pLX_317 24.6% 74.4% 80.3% V5 (many diffs) n/a
Download CSV