Construct: ORF TRCN0000467382
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016474.1_s317c1
- Derived from:
- ccsbBroadEn_03213
- DNA Barcode:
- CTACTTAACACCAAATGCCTTACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZDHHC9 (51114)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467382
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51114 | ZDHHC9 | zinc finger DHHC-type conta... | NM_001008222.3 | 100% | 100% | |
2 | human | 51114 | ZDHHC9 | zinc finger DHHC-type conta... | NM_016032.4 | 100% | 100% | |
3 | human | 51114 | ZDHHC9 | zinc finger DHHC-type conta... | XM_011531348.3 | 52.8% | 45.2% | (many diffs) |
4 | human | 51114 | ZDHHC9 | zinc finger DHHC-type conta... | XR_001755694.2 | 23.3% | 1_394del;1067_1176del;1597_4681del | |
5 | mouse | 208884 | Zdhhc9 | zinc finger, DHHC domain co... | NM_172465.4 | 93.4% | 98.3% | (many diffs) |
6 | mouse | 208884 | Zdhhc9 | zinc finger, DHHC domain co... | XM_006541454.3 | 93.4% | 98.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1158
- ORF length:
- 1092
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tgggcatgtc tgtgatggtg gtgagaaaga aggtgacacg gaaatgggag aaactcccag 121 gcaggaacac cttttgctgt gatggccgcg tcatgatggc ccggcaaaag ggcattttct 181 acctgaccct tttcctcatc ctggggacat gtacactctt cttcgccttt gagtgccgct 241 acctggctgt tcagctgtct cctgccatcc ctgtatttgc tgccatgctc ttccttttct 301 ccatggctac actgttgagg accagcttca gtgaccctgg agtgattcct cgggcgctac 361 cagatgaagc agctttcata gaaatggaga tagaagctac caatggtgcg gtgccccagg 421 gccagcgacc accgcctcgt atcaagaatt tccagataaa caaccagatt gtgaaactga 481 aatactgtta cacatgcaag atcttccggc ctccccgggc ctcccattgc agcatctgtg 541 acaactgtgt ggagcgcttc gaccatcact gcccctgggt ggggaattgt gttggaaaga 601 ggaactaccg ctacttctac ctcttcatcc tttctctctc cctcctcaca atctatgtct 661 tcgccttcaa catcgtctat gtggccctca aatctttgaa aattggcttc ttGGAGACAT 721 TGAAAGAAAC TCCTGGAACT GTTCTAGAAG TCCTCATTTG CTTCTTTACA CTCTGGTCCG 781 TCGTGGGACT GACTGGATTT CATACTTTCC TCGTGGCTCT CAACCAGACA ACCAATGAAG 841 ACATCAAAGG ATCATGGACA GGGAAGAATC GCGTCCAGAA TCCCTACAGC CATGGCAATA 901 TTGTGAAGAA CTGCTGTGAA GTGCTGTGTG GCCCCTTGCC CCCCAGTGTG CTGGATCGAA 961 GGGGTATTTT GCCACTGGAG GAAAGTGGAA GTCGACCTCC CAGTACTCAA GAGACCAGTA 1021 GCAGCCTCTT GCCACAGAGC CCAGCCCCCA CAGAACACCT GAACTCAAAT GAGATGCCGG 1081 AGGACAGCAG CACTCCCGAA GAGATGCCAC CTCCAGAGCC CCCAGAGCCA CCACAGGAGG 1141 CAGCTGAAGC TGAGAAGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1201 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1261 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACTACTTA ACACCAAATG 1321 CCTTACGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt