Transcript: Mouse NM_172465.4

Mus musculus zinc finger, DHHC domain containing 9 (Zdhhc9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc9 (208884)
Length:
2995
CDS:
347..1441

Additional Resources:

NCBI RefSeq record:
NM_172465.4
NBCI Gene record:
Zdhhc9 (208884)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175445 CGCCTTTAACATCGTCTATGT pLKO.1 943 CDS 100% 4.950 6.930 N Zdhhc9 n/a
2 TRCN0000193907 CTCAATCAGACCACCAATGAA pLKO.1 1100 CDS 100% 5.625 3.938 N Zdhhc9 n/a
3 TRCN0000193342 CAACCAGATTGTGAAACTGAA pLKO.1 742 CDS 100% 4.950 3.465 N Zdhhc9 n/a
4 TRCN0000193662 CCATTGTAGCATCTGTGACAA pLKO.1 805 CDS 100% 4.950 3.465 N Zdhhc9 n/a
5 TRCN0000174331 CCTCCTCACAATTTATGTCTT pLKO.1 922 CDS 100% 4.950 3.465 N Zdhhc9 n/a
6 TRCN0000137668 GAGGAACTACCGCTACTTCTA pLKO.1 880 CDS 100% 4.950 3.465 N ZDHHC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03213 pDONR223 100% 93.4% 98.3% None (many diffs) n/a
2 ccsbBroad304_03213 pLX_304 0% 93.4% 98.3% V5 (many diffs) n/a
3 TRCN0000467382 CTACTTAACACCAAATGCCTTACG pLX_317 41% 93.4% 98.3% V5 (many diffs) n/a
Download CSV