Transcript: Human NM_016032.4

Homo sapiens zinc finger DHHC-type containing 9 (ZDHHC9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
ZDHHC9 (51114)
Length:
4571
CDS:
395..1489

Additional Resources:

NCBI RefSeq record:
NM_016032.4
NBCI Gene record:
ZDHHC9 (51114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016032.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137668 GAGGAACTACCGCTACTTCTA pLKO.1 928 CDS 100% 4.950 6.930 N ZDHHC9 n/a
2 TRCN0000134395 GAAGTCCTCATTTGCTTCTTT pLKO.1 1076 CDS 100% 5.625 3.938 N ZDHHC9 n/a
3 TRCN0000193342 CAACCAGATTGTGAAACTGAA pLKO.1 790 CDS 100% 4.950 3.465 N Zdhhc9 n/a
4 TRCN0000135265 CCAGACAACCAATGAAGACAT pLKO.1 1153 CDS 100% 4.950 3.465 N ZDHHC9 n/a
5 TRCN0000138652 CCATTGCAGCATCTGTGACAA pLKO.1 853 CDS 100% 4.950 3.465 N ZDHHC9 n/a
6 TRCN0000134134 CTGTTACACATGCAAGATCTT pLKO.1 814 CDS 100% 4.950 3.465 N ZDHHC9 n/a
7 TRCN0000137411 GTCTGTGATGGTGGTGAGAAA pLKO.1 397 CDS 100% 4.950 3.465 N ZDHHC9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016032.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03213 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03213 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467382 CTACTTAACACCAAATGCCTTACG pLX_317 41% 100% 100% V5 n/a
Download CSV