Construct: ORF TRCN0000467414
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017055.1_s317c1
- Derived from:
- ccsbBroadEn_07102
- DNA Barcode:
- AACTTTTCCTCGATACTAAAAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSG101 (7251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467414
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7251 | TSG101 | tumor susceptibility 101 | NM_006292.4 | 99.9% | 99.7% | 1027T>C |
| 2 | human | 7251 | TSG101 | tumor susceptibility 101 | XM_005253108.4 | 86.5% | 86.4% | 0_1ins156;871T>C |
| 3 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | NM_021884.4 | 89.4% | 94.3% | (many diffs) |
| 4 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | XM_006540788.3 | 80.9% | 85.6% | (many diffs) |
| 5 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | NM_001348088.1 | 77% | 81.3% | (many diffs) |
| 6 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | XM_006540789.3 | 77% | 81.3% | (many diffs) |
| 7 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | NM_001348089.1 | 67.8% | 72.1% | (many diffs) |
| 8 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | XM_006540790.3 | 67.8% | 72.1% | (many diffs) |
| 9 | mouse | 22088 | Tsg101 | tumor susceptibility gene 101 | XR_391333.3 | 61% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1236
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggtgtcggag agccagctca agaaaatggt gtccaagtac aaatacagag 121 acctaactgt acgtgaaact gtcaatgtta ttactctata caaagatctc aaacctgttt 181 tggattcata tgtttttaac gatggcagtt ccagggaact aatgaacctc actggaacaa 241 tccctgtgcc ttatagaggt aatacataca atattccaat atgcctatgg ctactggaca 301 catacccata taatccccct atctgttttg ttaagcctac tagttcaatg actattaaaa 361 caggaaagca tgttgatgca aatgggaaga tatatcttcc ttatctacat gaatggaaac 421 acccacagtc agacttgttg gggcttattc aggtcatgat tgtggtattt ggagatgaac 481 ctccagtctt ctctcgtcct atttcggcat cctatccgcc ataccaggca acggggccac 541 caaatacttc ctacatgcca ggcatgccag gtggaatctc tccataccca tccggatacc 601 ctcccaatcc cagtggttac ccaggctgtc cttacccacc tggtggtcca tatcctgcca 661 caacaagttc tcagtaccct tctcagcctc ctgtgaccac tgttggtccc agtagggatg 721 gcacaatcag cgaggacacc atccgagcct ctctcatctc tgcggtcagt gacaaactga 781 gatggcggat gaaggaggaa atggatcgtg cccaggcaga gctcaatgcc ttgaaacgaa 841 cagaagaaga ccTGAAAAAG GGTCACCAGA AACTGGAAGA GATGGTTACC CGTTTAGATC 901 AAGAAGTAGC CGAGGTTGAT AAAAACATAG AACTTTTGAA AAAGAAGGAT GAAGAACTCA 961 GTTCTGCTCT GGAAAAAATG GAAAATCAGT CTGAAAACAA TGATATCGAT GAAGTTATCA 1021 TTCCCACAGC TCCCTTATAC AAACAGATCC TGAATCTGTA TGCAGAAGAA AACGCTATTG 1081 AAGACACTAT CCTTTACTTG GGAGAAGCCT TGAGAAGGGG CGTGATAGAC CTGGATGTCT 1141 TCCTGAAGCA TGTACGTCTT CTGTCCCGTA AACAGTTCCA GCTGAGGGCA CTAATGCAAA 1201 AAGCAAGAAA GACTGCCGGT CTCAGTGACC TCTACTGCCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 AAACTTTTCC TCGATACTAA AAATCACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt