Transcript: Mouse XM_006540789.3

PREDICTED: Mus musculus tumor susceptibility gene 101 (Tsg101), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsg101 (22088)
Length:
1378
CDS:
110..1126

Additional Resources:

NCBI RefSeq record:
XM_006540789.3
NBCI Gene record:
Tsg101 (22088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054603 CCCGTAAACAGTTCCAGCTAA pLKO.1 1053 CDS 100% 4.950 6.930 N Tsg101 n/a
2 TRCN0000054606 GCTATTGAAGACACTATCTTT pLKO.1 962 CDS 100% 5.625 4.500 N Tsg101 n/a
3 TRCN0000054604 CGTCCGTCAAACTGTCAATGT pLKO.1 172 CDS 100% 4.950 3.960 N Tsg101 n/a
4 TRCN0000054607 GCCTACTGTTTCTGCATCCTA pLKO.1 541 CDS 100% 3.000 2.100 N Tsg101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07102 pDONR223 100% 77% 81.3% None (many diffs) n/a
2 ccsbBroad304_07102 pLX_304 0% 77% 81.3% V5 (many diffs) n/a
3 TRCN0000467414 AACTTTTCCTCGATACTAAAAATC pLX_317 33.1% 77% 81.3% V5 (many diffs) n/a
Download CSV