Construct: ORF TRCN0000467450
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014553.1_s317c1
- Derived from:
- ccsbBroadEn_13214
- DNA Barcode:
- ACAATAACCCCACTAAAGACAATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FRMPD2 (143162)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467450
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 143162 | FRMPD2 | FERM and PDZ domain contain... | XM_017015744.1 | 100% | 100% | |
| 2 | human | 143162 | FRMPD2 | FERM and PDZ domain contain... | NM_001042512.2 | 81.5% | 81.5% | 1_177del |
| 3 | human | 728798 | FRMPD2B | FERM and PDZ domain contain... | NR_033172.1 | 40.1% | (many diffs) | |
| 4 | human | 143162 | FRMPD2 | FERM and PDZ domain contain... | NM_001318191.1 | 20.3% | 20.3% | 1_3069del |
| 5 | human | 143162 | FRMPD2 | FERM and PDZ domain contain... | NM_001018071.4 | 19.9% | 19.9% | 1_3144del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg agatgaacgc acggctgttt ccttggtaac agccttgcct ggcaggcctt 121 cgagctgtgt ctcagtgaca gatggtccta agtttgaagt caaactaaaa aagaatgcca 181 atggtttggg attcagtttc gtgcagatgg agaaagagag ctgcagccat ctcaaaagtg 241 atcttgtgag gattaagagg ctctttccgg ggcagccagc tgaggagaat ggggccattg 301 cagctggtga cattatcctg gccgtgaatg gaaggtccac ggaaggcctc atcttccagg 361 aggtgctgca tttactgaga ggggccccac aggaagtcac gctcctcctt tgccgacccc 421 ctccaggtgc gctgccTGAG CTGGAGCAGG AATGGCAGAC ACCTGAACTC TCAGCTGACA 481 AAGAATTCAC CAGGGCAACA TGTACTGACT CATGTACCAG CCCCATCCTG GATCAAGAGG 541 ACAGCTGGAG GGACAGTGCC TCCCCAGATG CAGGGGAAGG CCTGGGTCTC AGGCCAGAGT 601 CTTCCCAAAA GGCCATCAGA GAGGCACAAT GGGGCCAAAA CAGAGAGAGA CCTTGGGCCA 661 GTTCCTTGAC ACATTCTCCT GAGTCCCACC CTCATTTATG CAAACTTCAC CAAGAAAGGG 721 ATGAATCAAC ATTGGCGACC TCTTTGGAAA AGGATGTGAG GCAAAACTGC TATTCAGTTT 781 GTGATATCAT GAGACTTGGA AGATATTCCT TCTCATCTCC TCTAACCAGA CTTTCGACAG 841 ATATTTTCGG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAACAATA ACCCCACTAA AGACAATAAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt