Transcript: Human NR_033172.1

Homo sapiens FERM and PDZ domain containing 2B, pseudogene (FRMPD2B), non-coding RNA.

Source:
NCBI, updated 2018-10-27
Taxon:
Homo sapiens (human)
Gene:
FRMPD2B (728798)
Length:
1947
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033172.1
NBCI Gene record:
FRMPD2B (728798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256106 AGCTTGCCGCATCTCTAAATA pLKO_005 1393 3UTR 100% 15.000 7.500 Y FRMPD2B n/a
2 TRCN0000256108 CCAGACTTTCGACAGATATTT pLKO_005 1158 3UTR 100% 15.000 7.500 Y FRMPD2B n/a
3 TRCN0000256339 GGTTCCAAAGAAGTCAATAAA pLKO_005 1701 3UTR 100% 15.000 7.500 Y FRMPD2B n/a
4 TRCN0000256340 ACCAGACTTTCGACAGATATT pLKO_005 1157 3UTR 100% 13.200 6.600 Y FRMPD2B n/a
5 TRCN0000256109 AGTGATCTTGTGAGGATTAAG pLKO_005 569 3UTR 100% 13.200 6.600 Y FRMPD2B n/a
6 TRCN0000265795 CATGAGACTTGGAAGATATTC pLKO_005 1120 3UTR 100% 13.200 6.600 Y FRMPD2B n/a
7 TRCN0000265796 CCATTGCAGCTGGTGACATTA pLKO_005 627 3UTR 100% 13.200 6.600 Y FRMPD2B n/a
8 TRCN0000256338 TCCTGAGTCCCACCCTCATTT pLKO_005 1009 3UTR 100% 13.200 6.600 Y FRMPD2B n/a
9 TRCN0000256105 ACATTATCCTGGCCGTGAATG pLKO_005 642 3UTR 100% 10.800 5.400 Y FRMPD2B n/a
10 TRCN0000082783 CGCATCTCTAAATAGGCAAAT pLKO.1 1400 3UTR 100% 10.800 5.400 Y FRMPD2 n/a
11 TRCN0000256107 GAAAGGGATGAATCAACATTG pLKO_005 1046 3UTR 100% 10.800 5.400 Y FRMPD2B n/a
12 TRCN0000082786 GTGAGGATTAAGAGGCTCTTT pLKO.1 578 3UTR 100% 4.950 2.475 Y FRMPD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13214 pDONR223 100% 40.1% None (many diffs) n/a
2 ccsbBroad304_13214 pLX_304 0% 40.1% V5 (many diffs) n/a
3 TRCN0000467450 ACAATAACCCCACTAAAGACAATA pLX_317 52.6% 40.1% V5 (many diffs) n/a
Download CSV