Construct: ORF TRCN0000467484
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004946.1_s317c1
- Derived from:
- ccsbBroadEn_14432
- DNA Barcode:
- AAAATAGTGATAACCTATCGGGCG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANKS6 (203286)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467484
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_024447445.1 | 28.8% | 24.3% | (many diffs) |
2 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_006716999.3 | 26.2% | 20.6% | (many diffs) |
3 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | NM_173551.5 | 25.3% | 19.8% | (many diffs) |
4 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_017014445.1 | 25.3% | 19.8% | (many diffs) |
5 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_006716998.3 | 25.3% | 19.8% | (many diffs) |
6 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_005251794.4 | 25% | 19.5% | (many diffs) |
7 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_005251793.4 | 24.9% | 19.5% | (many diffs) |
8 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XR_428520.3 | 19.3% | (many diffs) | |
9 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XR_242576.3 | 17.8% | (many diffs) | |
10 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XR_929736.2 | 17.8% | (many diffs) | |
11 | human | 203286 | ANKS6 | ankyrin repeat and sterile ... | XM_024447447.1 | 16.1% | 12.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 789
- ORF length:
- 723
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc aattagggat gacataagct ggcccccgag tgctgtgtgt tcagtgtcac 121 taattctcca tcttcctggc agatttgggc atgtgagtgt ggcacacctc ctgttggatc 181 acggggctga tgtcaatgcc cagaaccggc tgggggccag tgtgctcact gtggcttctc 241 ggggcggcca cctgggtgtg gtgaagctgc tcctggaagc cggtgccttt gtggaccatc 301 accacccttc aggcgagcaa ctggggttgg gcggcagcag ggatgagccc ttggacatca 361 cagccctgat ggctgccatc cagcacgggc acgaggccgt ggtgcgtcta ctgatggagt 421 ggggcgcgga ccccaaccAC GCAGCCCGGA CCGTGGGCTG GAGCCCGCTG ATGCTGGCCG 481 CACTCACTGG GCGGCTTGGA GTGGCCCAGC AGCTGGTGGA GAAGGGCGCC AACCCTGACC 541 ACCTCAGCGT GCTGGAGAAG ACCGCCTTCG AGGTTGCACT GGACTGCAAG CACAGGGACC 601 TTGTAGACTA CCTGGACCCG CTGACCACCG TCAGGCCCAA AACAGGTCAG GCTGCATGCC 661 CCCCGTGGCT TCACAGAGGA CCCCAAATTG TGTTTATGTG GCTTAAGCTG AGGATTGCTC 721 TACTGGAAGG ACACGCAGAA CTCAGAGTCC AGCCCTGCAG ACCACTGAGA CTGAGGAATT 781 GGTGTCTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 841 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 901 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAAAAATAG TGATAACCTA TCGGGCGACG 961 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt