Construct: ORF TRCN0000467658
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001702.1_s317c1
- Derived from:
- ccsbBroadEn_03513
- DNA Barcode:
- CCTAGCCCCACACAGCCTATTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SUSD4 (55061)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467658
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55061 | SUSD4 | sushi domain containing 4 | NM_001037175.3 | 100% | 100% | |
| 2 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_024447940.1 | 100% | 100% | |
| 3 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001589.1 | 80.1% | 67% | 1_52del;200_363del |
| 4 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_005273169.1 | 54.7% | 51.1% | (many diffs) |
| 5 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_006711408.2 | 54.7% | 51.1% | (many diffs) |
| 6 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_011509685.1 | 54.7% | 51.1% | (many diffs) |
| 7 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_024447936.1 | 54.7% | 51.1% | (many diffs) |
| 8 | human | 55061 | SUSD4 | sushi domain containing 4 | NM_017982.4 | 54.6% | 51.3% | (many diffs) |
| 9 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001587.1 | 54.6% | 51.3% | (many diffs) |
| 10 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001588.1 | 54.6% | 51.3% | (many diffs) |
| 11 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_024447937.1 | 54.6% | 51.3% | (many diffs) |
| 12 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001585.1 | 49.1% | 37.8% | (many diffs) |
| 13 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001586.1 | 49.1% | 37.8% | (many diffs) |
| 14 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001583.1 | 47.9% | 36.8% | (many diffs) |
| 15 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_017001584.1 | 47.7% | 36.9% | (many diffs) |
| 16 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_011509687.1 | 22.8% | 18.7% | (many diffs) |
| 17 | human | 55061 | SUSD4 | sushi domain containing 4 | XM_005273172.1 | 22.6% | 18.8% | (many diffs) |
| 18 | mouse | 96935 | Susd4 | sushi domain containing 4 | XM_006497061.3 | 50% | 46% | (many diffs) |
| 19 | mouse | 96935 | Susd4 | sushi domain containing 4 | XM_006497063.1 | 50% | 46% | (many diffs) |
| 20 | mouse | 96935 | Susd4 | sushi domain containing 4 | NM_144796.4 | 49.7% | 46.2% | (many diffs) |
| 21 | mouse | 96935 | Susd4 | sushi domain containing 4 | XM_006497064.3 | 49.7% | 46.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta tcatggaatg aacccgagca atggagatgg atttctagag cagcagcagc 121 agcagcagca acctcagtcc ccccagagac tcttggccgt gatcctgtgg tttcagctgg 181 cgctgtgctt cggccctgca cagctcacgg gcgggttcga tgaccttcaa gtgtgtgctg 241 accccggcat tcccgagaat ggcttcagga cccccagcgg aggggttttc tttgaaggct 301 ctgtagcccg atttcactgc caagacggat tcaagctgaa gggcgctaca aagagactgt 361 gtttgaagca ttttaatgga accctaggct ggatcccaag tgataattcc atctgtgtgc 421 aagaagattg ccgtatccct caaatcgaag atgctgagat tcataacaag acatatagac 481 atggagagaa gctaatcatc acttgtcatg aaggattcaa gatccggtac cccgacctac 541 acaatatggt ttcattatgt cgcgatgatg gaacgtggaa taatctgccc atctgtcaag 601 gctgcctgag acctctagcc tcttctaatG GCTATGTAAA CATCTCTGAG CTCCAGACCT 661 CCTTCCCGGT GGGGACTGTG ATCTCCTATC GCTGCTTTCC CGGATTTAAA CTTGATGGGT 721 CTGCGTATCT TGAGTGCTTA CAAAACCTTA TCTGGTCGTC CAGCCCACCC CGGTGCCTTG 781 CTCTGGAAGG AGGAAGACCT GAACATCTTT TCCCTGTCCT TTATTTCCCA CACATCAGGT 841 TGGCAGCTGC TGTGCTTTAT TTTTGCCCTG TGTTAAAGTC CTCTCCCACC CCAGCACCTA 901 CCTGTTCCTC AACTAGCACC ACCACATCTC TGTTCTACCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ACCTAGCCCC ACACAGCCTA TTGTTACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt