Transcript: Mouse XM_006497063.1

PREDICTED: Mus musculus sushi domain containing 4 (Susd4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Susd4 (96935)
Length:
2907
CDS:
60..1538

Additional Resources:

NCBI RefSeq record:
XM_006497063.1
NBCI Gene record:
Susd4 (96935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345371 TATGGTAAGTCACGGAGATTT pLKO_005 806 CDS 100% 13.200 18.480 N Susd4 n/a
2 TRCN0000247777 TGTACAACCTGGTTTCGTTAT pLKO_005 532 CDS 100% 10.800 15.120 N Susd4 n/a
3 TRCN0000247778 ACGGAGAGAAGTTAGTCATTG pLKO_005 475 CDS 100% 10.800 7.560 N Susd4 n/a
4 TRCN0000345296 CATAAGGACAGTGATTCATAC pLKO_005 1647 3UTR 100% 10.800 7.560 N Susd4 n/a
5 TRCN0000216766 GAGTGCTTACACAACCTTATC pLKO.1 726 CDS 100% 10.800 7.560 N Susd4 n/a
6 TRCN0000173989 GTAACCCGATTTCACTGCCAA pLKO.1 297 CDS 100% 2.640 1.848 N Susd4 n/a
7 TRCN0000257779 TCGCTGCTTCCCTGGATTTAA pLKO_005 683 CDS 100% 15.000 9.000 N Susd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03513 pDONR223 100% 50% 46% None (many diffs) n/a
2 ccsbBroad304_03513 pLX_304 0% 50% 46% V5 (many diffs) n/a
3 TRCN0000467658 CCTAGCCCCACACAGCCTATTGTT pLX_317 35.6% 50% 46% V5 (many diffs) n/a
Download CSV