Transcript: Human XM_017001587.1

PREDICTED: Homo sapiens sushi domain containing 4 (SUSD4), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUSD4 (55061)
Length:
3037
CDS:
199..1671

Additional Resources:

NCBI RefSeq record:
XM_017001587.1
NBCI Gene record:
SUSD4 (55061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179934 CGATGATGGAACGTGGAATAA pLKO.1 696 CDS 100% 13.200 18.480 N SUSD4 n/a
2 TRCN0000431899 ATGGTGAGTCACGGAGATTTC pLKO_005 940 CDS 100% 10.800 15.120 N SUSD4 n/a
3 TRCN0000430235 ATCAAGTCTACTGCATCAAAT pLKO_005 1091 CDS 100% 13.200 9.240 N SUSD4 n/a
4 TRCN0000428670 CGAAGATGCTGAGATTCATAA pLKO_005 579 CDS 100% 13.200 9.240 N SUSD4 n/a
5 TRCN0000436187 GAAGGCTCTGTAGCCCGATTT pLKO_005 427 CDS 100% 10.800 7.560 N SUSD4 n/a
6 TRCN0000183661 CCTACACAATATGGTTTCATT pLKO.1 669 CDS 100% 5.625 3.938 N SUSD4 n/a
7 TRCN0000180271 CGTGGAATAATCTGCCCATCT pLKO.1 707 CDS 100% 4.050 2.835 N SUSD4 n/a
8 TRCN0000179713 GCAGTGAGAAAGGAAAGGAAA pLKO.1 2280 3UTR 100% 4.950 2.970 N SUSD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03513 pDONR223 100% 54.6% 51.3% None (many diffs) n/a
2 ccsbBroad304_03513 pLX_304 0% 54.6% 51.3% V5 (many diffs) n/a
3 TRCN0000467658 CCTAGCCCCACACAGCCTATTGTT pLX_317 35.6% 54.6% 51.3% V5 (many diffs) n/a
Download CSV