Construct: ORF TRCN0000467692
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015192.1_s317c1
- Derived from:
- ccsbBroadEn_02703
- DNA Barcode:
- TACATTTCATATCCCCCCAGAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPRE3 (22924)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467692
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 22924 | MAPRE3 | microtubule associated prot... | NM_001303050.2 | 99.8% | 100% | 207C>T |
| 2 | human | 22924 | MAPRE3 | microtubule associated prot... | NM_012326.4 | 99.8% | 100% | 207C>T |
| 3 | human | 22924 | MAPRE3 | microtubule associated prot... | XM_006711967.4 | 94.5% | 94.6% | 207C>T;421_422ins45 |
| 4 | human | 22924 | MAPRE3 | microtubule associated prot... | XM_011532700.1 | 94.5% | 94.6% | 207C>T;421_422ins45 |
| 5 | human | 22924 | MAPRE3 | microtubule associated prot... | XM_017003597.1 | 94.5% | 94.6% | 207C>T;421_422ins45 |
| 6 | mouse | 100732 | Mapre3 | microtubule-associated prot... | NM_133350.2 | 91.8% | 99.2% | (many diffs) |
| 7 | mouse | 100732 | Mapre3 | microtubule-associated prot... | XM_006503623.3 | 91.8% | 99.2% | (many diffs) |
| 8 | mouse | 100732 | Mapre3 | microtubule-associated prot... | NM_001310516.1 | 86.4% | 93.9% | (many diffs) |
| 9 | mouse | 100732 | Mapre3 | microtubule-associated prot... | XM_017320579.1 | 86.4% | 93.9% | (many diffs) |
| 10 | mouse | 100732 | Mapre3 | microtubule-associated prot... | XM_006503625.3 | 62.3% | 56.9% | (many diffs) |
| 11 | mouse | 100732 | Mapre3 | microtubule-associated prot... | XR_376791.3 | 36.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 909
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgtcaatgtg tactccacat ctgtgaccag tgaaaatctg agtcgccatg 121 atatgcttgc atgggtcaac gactccctgc acctcaacta taccaagata gaacagcttt 181 gttcaggggc agcctactgc cagttcatgg acatgctctt ccccggctgt gtgcacttga 241 ggaaagtgaa gttccaggcc aaactagagc atgaatacat ccacaacttc aaggtgctgc 301 aagcagcttt caagaagatg ggtgttgaca aaatcattcc tgtagagaaa ttagtgaaag 361 gaaaattcca agataatttt gagtttattc agtggtttaa gaaattcttt gacgcaaact 421 atgatggaaa ggattacaac cctctgctgg cgcggcaggg ccaggacgta gcgccacctc 481 ctaacccagg tgatcagatc ttcaacaaat ccaagaaact cattggcaca gcagttccac 541 agaggacgtc ccccacaggc ccaaaaaaca tgcagacctc tggccggctg agcaatgtgg 601 cccccccctg cattctccgg aagaatcctc catcagcccg aaatggcggc catgagactg 661 atgcccaaat tcttgaactc aaccaacagc tggtggactt gaagctgaca gtggatgggc 721 tggagaagga acgtgacttc tacttcagca aacttcgtga catcgagctc atctgccagg 781 agcatgaaag tgaaaacagc cctgttatct caggcatcat tggcaTCCTC TATGCCACAG 841 AGGAAGGATT CGCACCCCCT GAGGACGATG AGATTGAAGA GCATCAACAA GAAGACCAGG 901 ACGAGTACTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATACATT TCATATCCCC CCAGAGCCAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt