Transcript: Human NM_012326.4

Homo sapiens microtubule associated protein RP/EB family member 3 (MAPRE3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
MAPRE3 (22924)
Length:
1890
CDS:
174..1019

Additional Resources:

NCBI RefSeq record:
NM_012326.4
NBCI Gene record:
MAPRE3 (22924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012326.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303470 ATCCTCCATCAGCCCGAAATG pLKO_005 733 CDS 100% 10.800 15.120 N MAPRE3 n/a
2 TRCN0000377333 GAAATTCTTTGACGCAAACTA pLKO_005 509 CDS 100% 5.625 7.875 N MAPRE3 n/a
3 TRCN0000303468 TGTCCACACCCACCCTATTTA pLKO_005 1232 3UTR 100% 15.000 10.500 N MAPRE3 n/a
4 TRCN0000303467 CATGAGACTGATGCCCAAATT pLKO_005 759 CDS 100% 13.200 9.240 N MAPRE3 n/a
5 TRCN0000303469 CTGTAGAGAAATTAGTGAAAG pLKO_005 448 CDS 100% 10.800 7.560 N MAPRE3 n/a
6 TRCN0000369595 TTTGACAAAGTCATTGGTATA pLKO_005 1351 3UTR 100% 10.800 7.560 N MAPRE3 n/a
7 TRCN0000061820 CCCTGTTATCTCAGGCATCAT pLKO.1 908 CDS 100% 4.950 3.465 N MAPRE3 n/a
8 TRCN0000087783 CCTTGCACTTTACCTGTTCTT pLKO.1 1391 3UTR 100% 4.950 3.465 N Mapre3 n/a
9 TRCN0000309106 CCTTGCACTTTACCTGTTCTT pLKO_005 1391 3UTR 100% 4.950 3.465 N Mapre3 n/a
10 TRCN0000061819 GCACCTCAACTATACCAAGAT pLKO.1 257 CDS 100% 4.950 3.465 N MAPRE3 n/a
11 TRCN0000061821 GCCAGGAGCATGAAAGTGAAA pLKO.1 883 CDS 100% 4.950 3.465 N MAPRE3 n/a
12 TRCN0000315696 GCCAGGAGCATGAAAGTGAAA pLKO_005 883 CDS 100% 4.950 3.465 N MAPRE3 n/a
13 TRCN0000061822 GCTTTCAAGAAGATGGGTGTT pLKO.1 414 CDS 100% 4.050 2.430 N MAPRE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012326.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02703 pDONR223 100% 99.8% 100% None 207C>T n/a
2 ccsbBroad304_02703 pLX_304 0% 99.8% 100% V5 207C>T n/a
3 TRCN0000467692 TACATTTCATATCCCCCCAGAGCC pLX_317 10.8% 99.8% 100% V5 207C>T n/a
Download CSV