Transcript: Mouse NM_133350.2

Mus musculus microtubule-associated protein, RP/EB family, member 3 (Mapre3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mapre3 (100732)
Length:
2021
CDS:
266..1111

Additional Resources:

NCBI RefSeq record:
NM_133350.2
NBCI Gene record:
Mapre3 (100732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087787 CACCTCAATTATACCAAGATT pLKO.1 350 CDS 100% 5.625 7.875 N Mapre3 n/a
2 TRCN0000315513 CACCTCAATTATACCAAGATT pLKO_005 350 CDS 100% 5.625 7.875 N Mapre3 n/a
3 TRCN0000377333 GAAATTCTTTGACGCAAACTA pLKO_005 601 CDS 100% 5.625 7.875 N MAPRE3 n/a
4 TRCN0000087784 CCCGTAGAGAAGTTAGTGAAA pLKO.1 539 CDS 100% 4.950 6.930 N Mapre3 n/a
5 TRCN0000309107 CCCGTAGAGAAGTTAGTGAAA pLKO_005 539 CDS 100% 4.950 6.930 N Mapre3 n/a
6 TRCN0000087786 CGAGATTTCTATTTCAGCAAA pLKO.1 932 CDS 100% 4.950 6.930 N Mapre3 n/a
7 TRCN0000315588 CGAGATTTCTATTTCAGCAAA pLKO_005 932 CDS 100% 4.950 6.930 N Mapre3 n/a
8 TRCN0000087785 GCACCTCAATTATACCAAGAT pLKO.1 349 CDS 100% 4.950 3.960 N Mapre3 n/a
9 TRCN0000369595 TTTGACAAAGTCATTGGTATA pLKO_005 1484 3UTR 100% 10.800 7.560 N MAPRE3 n/a
10 TRCN0000087783 CCTTGCACTTTACCTGTTCTT pLKO.1 1524 3UTR 100% 4.950 3.465 N Mapre3 n/a
11 TRCN0000309106 CCTTGCACTTTACCTGTTCTT pLKO_005 1524 3UTR 100% 4.950 3.465 N Mapre3 n/a
12 TRCN0000061822 GCTTTCAAGAAGATGGGTGTT pLKO.1 506 CDS 100% 4.050 2.430 N MAPRE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02703 pDONR223 100% 91.8% 99.2% None (many diffs) n/a
2 ccsbBroad304_02703 pLX_304 0% 91.8% 99.2% V5 (many diffs) n/a
3 TRCN0000467692 TACATTTCATATCCCCCCAGAGCC pLX_317 10.8% 91.8% 99.2% V5 (many diffs) n/a
Download CSV