Construct: ORF TRCN0000467804
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005308.1_s317c1
- Derived from:
- ccsbBroadEn_14005
- DNA Barcode:
- ACTAACCTGCAACACTGAGAGCCG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LIN7A (8825)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467804
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8825 | LIN7A | lin-7 homolog A, crumbs cel... | NM_004664.3 | 99.8% | 99.1% | 694delA |
| 2 | human | 8825 | LIN7A | lin-7 homolog A, crumbs cel... | XM_011538928.3 | 70.7% | 67% | (many diffs) |
| 3 | human | 8825 | LIN7A | lin-7 homolog A, crumbs cel... | NM_001324423.2 | 69.3% | 68.6% | 0_1ins213;481delA |
| 4 | human | 8825 | LIN7A | lin-7 homolog A, crumbs cel... | NR_136888.2 | 11.4% | (many diffs) | |
| 5 | human | 8825 | LIN7A | lin-7 homolog A, crumbs cel... | NR_136887.2 | 9.4% | (many diffs) | |
| 6 | mouse | 108030 | Lin7a | lin-7 homolog A (C. elegans) | NM_001039354.1 | 92.2% | 98.7% | (many diffs) |
| 7 | mouse | 108030 | Lin7a | lin-7 homolog A (C. elegans) | XM_006513031.3 | 87.5% | 93.5% | (many diffs) |
| 8 | mouse | 108030 | Lin7a | lin-7 homolog A (C. elegans) | XM_006513032.1 | 63.6% | 68.2% | (many diffs) |
| 9 | mouse | 108030 | Lin7a | lin-7 homolog A (C. elegans) | NM_001033223.2 | 42.9% | 46.3% | (many diffs) |
| 10 | mouse | 108030 | Lin7a | lin-7 homolog A (C. elegans) | NM_001284329.1 | 42.9% | 46.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 768
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctgaagccg agcgtcactt cggctcccac ggcagacatg gcgacattga 121 cagtggtcca gccgctcacc ctggacagag atgttgcaag agcaattgaa ttactggaaa 181 aactacagga atctggagaa gtaccagtgc acaagctaca atccctcaaa aaagtgcttc 241 agagtgagtt ttgtacagct attcgagagg tgtatcaata tatgcatgaa acgataactg 301 ttaatggctg tcccgaattc cgtgcgaggg caacagcaaa ggcaacagtt gcagcttttg 361 cagctagtga aggccactcc caccctcgag tagttgaact gccaaagact gatgaaggcc 421 ttggttttaa tgtgatggga ggaaaggagc aaaatTCCCC CATTTATATC TCTCGCATAA 481 TTCCTGGAGG GGTGGCTGAA AGACACGGAG GCCTCAAAAG AGGAGACCAG CTGCTATCAG 541 TGAACGGAGT GAGTGTGGAA GGAGAACACC ATGAGAAAGC TGTGGAACTA CTCAAGGCTG 601 CTAAAGACAG CGTCAAGCTG GTGGTGCGAT ACACCCCAAA AGTTCTGGAA GAAATGGAGG 661 CTCGCTTTGA AAAGCTACGA ACAGCCAGGC GTCGGCAGCA GCAGCAATTG CTAATTCAGC 721 AGCAGCAACA GCAGCAGCAG CAACAAACAC AACAAAACCA CTGTCATTGC CAACTTTCTT 781 GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC 841 GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG 901 TGGAAAGGAC GAACTAACCT GCAACACTGA GAGCCGACGC GTTAAGTCga caatcaacct 961 ctggattaca aaatttgtga aagatt