Transcript: Human NR_136888.2

Homo sapiens lin-7 homolog A, crumbs cell polarity complex component (LIN7A), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
LIN7A (8825)
Length:
5971
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136888.2
NBCI Gene record:
LIN7A (8825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116869 GCATGAAACGATAACTGTTAA pLKO.1 201 3UTR 100% 13.200 18.480 N LIN7A n/a
2 TRCN0000416552 CGAGTAGTTGAACTGCCAAAG pLKO_005 381 3UTR 100% 6.000 8.400 N LIN7A n/a
3 TRCN0000116868 CCCATTTATATCTCTCGCATA pLKO.1 453 3UTR 100% 4.050 5.670 N LIN7A n/a
4 TRCN0000091565 CTATCAGTGAACGGAGTGAGT pLKO.1 528 3UTR 100% 2.640 3.696 N Lin7a n/a
5 TRCN0000116870 GAACTACTCAAGGCTGCTAAA pLKO.1 579 3UTR 100% 10.800 8.640 N LIN7A n/a
6 TRCN0000435589 AGACAACACTGATAATTATAC pLKO_005 847 3UTR 100% 13.200 9.240 N LIN7A n/a
7 TRCN0000429026 GGGAAAGCTACTTGATCAAAC pLKO_005 773 3UTR 100% 10.800 7.560 N LIN7A n/a
8 TRCN0000116871 CACAAGCTACAATCCCTCAAA pLKO.1 127 3UTR 100% 4.950 3.465 N LIN7A n/a
9 TRCN0000116867 GCTTCAGAATCCCAGCACATA pLKO.1 821 3UTR 100% 4.950 3.465 N LIN7A n/a
10 TRCN0000091567 CACCATGAGAAAGCTGTGGAA pLKO.1 561 3UTR 100% 2.640 1.848 N Lin7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14005 pDONR223 100% 11.4% None (many diffs) n/a
2 ccsbBroad304_14005 pLX_304 0% 11.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467804 ACTAACCTGCAACACTGAGAGCCG pLX_317 44.6% 11.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV