Transcript: Mouse XM_006513031.3

PREDICTED: Mus musculus lin-7 homolog A (C. elegans) (Lin7a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lin7a (108030)
Length:
6086
CDS:
263..928

Additional Resources:

NCBI RefSeq record:
XM_006513031.3
NBCI Gene record:
Lin7a (108030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091563 CCATTCGTTACCAAGGCAATT pLKO.1 1069 3UTR 100% 10.800 15.120 N Lin7a n/a
2 TRCN0000091564 GATTTACATCTCCCGCATCAT pLKO.1 619 CDS 100% 4.950 6.930 N Lin7a n/a
3 TRCN0000091565 CTATCAGTGAACGGAGTGAGT pLKO.1 692 CDS 100% 2.640 1.848 N Lin7a n/a
4 TRCN0000091566 AGCAACAACAACCACAACAAA pLKO.1 894 CDS 100% 5.625 3.375 N Lin7a n/a
5 TRCN0000091567 CACCATGAGAAAGCTGTGGAA pLKO.1 725 CDS 100% 2.640 1.584 N Lin7a n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2381 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000178741 CACACACATACACACACACAA pLKO.1 2371 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513031.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14005 pDONR223 100% 87.5% 93.5% None (many diffs) n/a
2 ccsbBroad304_14005 pLX_304 0% 87.5% 93.5% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467804 ACTAACCTGCAACACTGAGAGCCG pLX_317 44.6% 87.5% 93.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV