Construct: ORF TRCN0000467861
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007166.1_s317c1
- Derived from:
- ccsbBroadEn_03747
- DNA Barcode:
- CGTCGCGATAAGTGTACCACCCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCMF1 (56888)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467861
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 56888 | KCMF1 | potassium channel modulator... | NM_020122.5 | 100% | 100% | |
2 | human | 56888 | KCMF1 | potassium channel modulator... | XM_006712052.3 | 97.6% | 96.6% | (many diffs) |
3 | human | 56888 | KCMF1 | potassium channel modulator... | XM_011532990.1 | 86.6% | 86.6% | 0_1ins153 |
4 | human | 56888 | KCMF1 | potassium channel modulator... | XM_017004511.1 | 59.8% | 59.8% | 0_1ins459 |
5 | mouse | 74287 | Kcmf1 | potassium channel modulator... | NM_019715.2 | 94% | 97.3% | (many diffs) |
6 | mouse | 74287 | Kcmf1 | potassium channel modulator... | NM_001347231.1 | 81% | 83.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1209
- ORF length:
- 1143
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ccgacatgaa ggtgtcagct gtgatgcatg tttaaaagga aattttcgag 121 gtcgcagata taagtgttta atttgctacg attacgatct ttgtgcatct tgttatgaaa 181 gtggtgcaac aacaacaagg catacaactg accacccaat gcagtgcata ttaacaaggg 241 tagattttga tttatactat ggtggggaag ctttctctgt agagcagcca cagtctttta 301 cttgtcccta ttgtggaaaa atgggctata cggagacatc tcttcaagaa catgttactt 361 ctgaacatgc agaaacatca acagaagtga tttgtccaat atgtgcagcg ttacctggag 421 gcgatcctaa tcatgtcacg gatgactttg cagctcatct tacacttgaa cacagagccc 481 ctagagattt agatgaatcg agtggtgttc gacatgtacg tagaatgttt caccctggcc 541 ggggattagg aggtcctcgt gctcgtagat caaacatgca ctttactagc agttctactg 601 gtggactttc ttcttctcag agttcatatt ctccaagcaa tagggaagcc atggatccta 661 tagctgagct tttatctcag ttatcaggag tgagacgttc tgcaggagga cagcttaatt 721 cctctggccc ttccgcttct cagttacaac aactgcagat gcagctgcag ctagaacggc 781 agcatgccca ggcagcacgg caacaactgg agaccgcacg caacgcaacc cggcgtacta 841 acacaagcag tgtcaccact acaatcacac aatccacagc aacaaccaac atagctaata 901 cagaaagcag tcagcagact ctacagaatt cccagtttct tttaacaagg ttgaatgatc 961 ctaaaatgtc tgaaacggag cgccagtcca tggaaagcga gcgtgcagac cgcagcctgt 1021 ttgtccaaga gctccttctg tccactttag tgcgtgaaga gagctcatcc tcagatgagg 1081 atgatcgggg ggagatggca gattttggtg ctatgggctg tgtagatatt atgcctttag 1141 atgttgcttt agaaaaccta aatTTAAAAG AGAGTAATAA AGGAAATGAG CCTCCACCAC 1201 CTCCTCTTTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1261 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1321 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGTCGC GATAAGTGTA CCACCCAGAC 1381 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt