Transcript: Human XM_017004511.1

PREDICTED: Homo sapiens potassium channel modulatory factor 1 (KCMF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCMF1 (56888)
Length:
2961
CDS:
440..1126

Additional Resources:

NCBI RefSeq record:
XM_017004511.1
NBCI Gene record:
KCMF1 (56888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044731 CTGTCCACTTTAGTGCGTGAA pLKO.1 953 CDS 100% 4.050 5.670 N KCMF1 n/a
2 TRCN0000044729 CGTAGATCAAACATGCACTTT pLKO.1 479 CDS 100% 4.950 3.960 N KCMF1 n/a
3 TRCN0000288979 CGTAGATCAAACATGCACTTT pLKO_005 479 CDS 100% 4.950 3.960 N KCMF1 n/a
4 TRCN0000044730 GCAGTTCTACTGGTGGACTTT pLKO.1 504 CDS 100% 4.950 3.465 N KCMF1 n/a
5 TRCN0000288980 GCAGTTCTACTGGTGGACTTT pLKO_005 504 CDS 100% 4.950 3.465 N KCMF1 n/a
6 TRCN0000068925 GCTGTGTAGATATTATGCCTT pLKO.1 1032 CDS 100% 2.640 1.584 N Kcmf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03747 pDONR223 100% 59.8% 59.8% None 0_1ins459 n/a
2 ccsbBroad304_03747 pLX_304 0% 59.8% 59.8% V5 0_1ins459 n/a
3 TRCN0000467861 CGTCGCGATAAGTGTACCACCCAG pLX_317 4.8% 59.8% 59.8% V5 0_1ins459 n/a
Download CSV