Construct: ORF TRCN0000467947
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010978.1_s317c1
- Derived from:
- ccsbBroadEn_09259
- DNA Barcode:
- CACTATCCTACATTACGAAAAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGS8 (85397)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467947
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 85397 | RGS8 | regulator of G protein sign... | NM_033345.3 | 99.8% | 100% | 345A>C |
| 2 | human | 85397 | RGS8 | regulator of G protein sign... | XM_011510089.3 | 99.8% | 100% | 345A>C |
| 3 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002631.2 | 99.8% | 100% | 345A>C |
| 4 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002632.1 | 99.8% | 100% | 345A>C |
| 5 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002633.1 | 99.8% | 100% | 345A>C |
| 6 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002634.1 | 99.8% | 100% | 345A>C |
| 7 | human | 85397 | RGS8 | regulator of G protein sign... | XM_011510091.3 | 89.7% | 89.8% | 0_1ins60;285A>C |
| 8 | human | 85397 | RGS8 | regulator of G protein sign... | NM_001102450.2 | 88.9% | 87.3% | (many diffs) |
| 9 | human | 85397 | RGS8 | regulator of G protein sign... | NM_001369564.2 | 88.9% | 87.3% | (many diffs) |
| 10 | human | 85397 | RGS8 | regulator of G protein sign... | XM_005245555.4 | 88.9% | 87.3% | (many diffs) |
| 11 | human | 85397 | RGS8 | regulator of G protein sign... | XM_011510090.2 | 88.9% | 87.3% | (many diffs) |
| 12 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002635.1 | 88.9% | 87.3% | (many diffs) |
| 13 | human | 85397 | RGS8 | regulator of G protein sign... | XM_017002637.2 | 88.9% | 87.3% | (many diffs) |
| 14 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | NM_026380.3 | 81.5% | 85.8% | (many diffs) |
| 15 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529818.3 | 81.5% | 85.8% | (many diffs) |
| 16 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529819.3 | 81.5% | 85.8% | (many diffs) |
| 17 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529820.3 | 81.5% | 85.8% | (many diffs) |
| 18 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529821.3 | 81.5% | 85.8% | (many diffs) |
| 19 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | NM_001347115.1 | 80.8% | 87.8% | (many diffs) |
| 20 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529822.3 | 80.8% | 87.8% | (many diffs) |
| 21 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529824.3 | 80.8% | 87.8% | (many diffs) |
| 22 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529825.3 | 80.8% | 87.8% | (many diffs) |
| 23 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529826.3 | 80.8% | 87.8% | (many diffs) |
| 24 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529827.3 | 80.8% | 87.8% | (many diffs) |
| 25 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529828.3 | 80.8% | 87.8% | (many diffs) |
| 26 | mouse | 67792 | Rgs8 | regulator of G-protein sign... | XM_006529829.3 | 66.1% | 70.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 660
- ORF length:
- 594
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gaacacctta acccgaagcc tctctgacca tccagttggc aaagaccctc 121 aggccatgag gactggccaa agacagaaca aagggatgag gactcgactg ggatgcctgt 181 ctcacaagtc agactcgtgt agtgatttca cagctattct tccagacaaa cccaaccgcg 241 ctctcaagag attatcgaca gaagaagcta cgaggtgggc agattccttt gatgtgcttc 301 tctctcataa gtatggggtg gctgcattcc gtgccTTCTT GAAGACGGAG TTCAGTGAGG 361 AGAACCTGGA ATTCTGGTTG GCCTGTGAGG AGTTCAAGAA GACCAGGTCC ACTGCAAAAC 421 TGGTCTCTAA GGCCCATAGG ATCTTTGAGG AGTTTGTGGA TGTGCAGGCT CCACGGGAGG 481 TAAACATTGA CTTCCAGACC CGAGAAGCCA CGAGGAAGAA CCTGCAGGAG CCATCCCTGA 541 CTTGCTTTGA CCAAGCCCAA GGAAAAGTAC ACAGCCTCAT GGAGAAAGAC TCTTACCCCA 601 GGTTCCTGAG GTCCAAAATG TACTTAGATC TGCTGTCCCA AAGCCAGAGG AGGCTCAGTT 661 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 721 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 781 TTTATATATC TTGTGGAAAG GACGACACTA TCCTACATTA CGAAAAAAAA CGCGTTAAGT 841 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt