Transcript: Human XM_017002637.2

PREDICTED: Homo sapiens regulator of G protein signaling 8 (RGS8), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS8 (85397)
Length:
5949
CDS:
488..1030

Additional Resources:

NCBI RefSeq record:
XM_017002637.2
NBCI Gene record:
RGS8 (85397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414000 CTGACCATCCAGTTGGCAAAG pLKO_005 333 5UTR 100% 6.000 4.200 N RGS8 n/a
2 TRCN0000437731 CCTTCTTGAAGACGGAGTTCA pLKO_005 702 CDS 100% 4.950 3.465 N Rgs8 n/a
3 TRCN0000036851 CTCAAGAGATTATCGACAGAA pLKO.1 611 CDS 100% 4.950 3.465 N RGS8 n/a
4 TRCN0000106177 GAAGACCAGGTCAACTGCAAA pLKO.1 766 CDS 100% 4.950 3.465 N Rgs8 n/a
5 TRCN0000036850 CCATAGGATCTTTGAGGAGTT pLKO.1 802 CDS 100% 4.050 2.835 N RGS8 n/a
6 TRCN0000432203 TGCCTTCTTGAAGACGGAGTT pLKO_005 700 CDS 100% 4.050 2.835 N RGS8 n/a
7 TRCN0000036849 CGTGTAGTGATTTCACAGCTA pLKO.1 564 CDS 100% 2.640 1.848 N RGS8 n/a
8 TRCN0000036852 ACTTGCTTTGACCAAGCCCAA pLKO.1 908 CDS 100% 2.160 1.512 N RGS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16051 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16051 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465528 TCTGCTTATGCAGCGCAATCAGAC pLX_317 59.8% 100% 100% V5 n/a
4 ccsbBroadEn_09259 pDONR223 100% 88.9% 87.3% None (many diffs) n/a
5 ccsbBroad304_09259 pLX_304 0% 88.9% 87.3% V5 (many diffs) n/a
6 TRCN0000467947 CACTATCCTACATTACGAAAAAAA pLX_317 54.5% 88.9% 87.3% V5 (many diffs) n/a
Download CSV