Construct: ORF TRCN0000468052
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017314.1_s317c1
- Derived from:
- ccsbBroadEn_00670
- DNA Barcode:
- GGGACTATGCGTTACCATTCATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR4 (2828)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468052
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2828 | GPR4 | G protein-coupled receptor 4 | NM_005282.3 | 100% | 100% | |
2 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026607.2 | 100% | 100% | |
3 | human | 2828 | GPR4 | G protein-coupled receptor 4 | XM_017026608.1 | 100% | 100% | |
4 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | NM_175668.4 | 86.7% | 91.5% | (many diffs) |
5 | mouse | 319197 | Gpr4 | G protein-coupled receptor 4 | XM_006540048.3 | 86.7% | 91.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1152
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg caaccacacg tgggagggct gccacgtgga ctcgcgcgtg gaccacctct 121 ttccgccatc cctctacatc tttgtcatcg gcgtggggct gcccaccaac tgcctggctc 181 tgtgggcggc ctaccgccag gtgcaacagc gcaacgagct gggcgtctac ctgatgaacc 241 tcagcatcgc cgacctgctg tacatctgca cgctgccgct gtgggtggac tacttcctgc 301 accacgacaa ctggatccac ggccccgggt cctgcaagct ctttgggttc atcttctaca 361 ccaatatcta catcagcatc gccttcctgt gctgcatctc ggtggaccgc tacctggctg 421 tggcccaccc actccgcttc gcccgcctgc gccgcgtcaa gaccgccgtg gccgtgagct 481 ccgtggtctg ggccacggag ctgggcgcca actcggcgcc cctgttccat gacgagctct 541 tccgagaccg ctacaaccac accttctgct ttgagaagtt ccccatggaa ggctgggtgg 601 cctggatgaa cctctatcgg gtgttcgtgg gcttcctctt cccgtgggcg ctcatgctgc 661 tgtcgtaccg gggcatcctg cgggccgtgc ggggcagcgt gtccaccgag cgccaggaga 721 aggccaagat caagcggctg gccctcagcc tcatcgccat cgtgctggtc tgctttgcgc 781 cctatcacgt gctcttgctg tcccgcagcg ccatctaccT GGGCCGCCCC TGGGACTGCG 841 GCTTCGAGGA GCGCGTCTTT TCTGCATACC ACAGCTCACT GGCTTTCACC AGCCTCAACT 901 GTGTGGCGGA CCCCATCCTC TACTGCCTGG TCAACGAGGG CGCCCGCAGC GATGTGGCCA 961 AGGCCCTGCA CAACCTGCTC CGCTTTCTGG CCAGCGACAA GCCCCAGGAG ATGGCCAATG 1021 CCTCGCTCAC CCTGGAGACC CCACTCACCT CCAAGAGGAA CAGCACAGCC AAAGCCATGA 1081 CTGGCAGCTG GGCGGCCACT CCGCCCTCCC AGGGGGACCA GGTGCAGCTG AAGATGCTGC 1141 CGCCAGCACA ATGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1201 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1261 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGG ACTATGCGTT ACCATTCATC 1321 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t