Transcript: Mouse NM_175668.4

Mus musculus G protein-coupled receptor 4 (Gpr4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gpr4 (319197)
Length:
2884
CDS:
863..1960

Additional Resources:

NCBI RefSeq record:
NM_175668.4
NBCI Gene record:
Gpr4 (319197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175668.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028167 GATGAATCTGTACCGCGTCTT pLKO.1 1408 CDS 100% 4.050 5.670 N Gpr4 n/a
2 TRCN0000418729 AGACCCACTTGGACCACAAAG pLKO_005 2314 3UTR 100% 10.800 7.560 N Gpr4 n/a
3 TRCN0000446327 GCTTGGTTTCTGGCAGATAAG pLKO_005 2216 3UTR 100% 10.800 7.560 N Gpr4 n/a
4 TRCN0000028142 CCGAGGAAAGATTTGGAAGTT pLKO.1 2291 3UTR 100% 4.950 3.465 N Gpr4 n/a
5 TRCN0000028191 CCTGCTGTACATCTGCACTTT pLKO.1 1057 CDS 100% 4.950 3.465 N Gpr4 n/a
6 TRCN0000028164 CTTCCCACCATCTCTCTACAT pLKO.1 922 CDS 100% 4.950 3.465 N Gpr4 n/a
7 TRCN0000028157 GCCAGGAGAAAGTCAAGATCA pLKO.1 1515 CDS 100% 4.950 3.465 N Gpr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175668.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00670 pDONR223 100% 86.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_00670 pLX_304 0% 86.7% 91.5% V5 (many diffs) n/a
3 TRCN0000468052 GGGACTATGCGTTACCATTCATCT pLX_317 31% 86.7% 91.5% V5 (many diffs) n/a
4 TRCN0000489437 CCGGATTACAAACGAACAAAACAC pLX_317 30.6% 86.7% 91.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488819 AGCGTGAACCTTCTCTCTCCGGGA pLX_317 29.6% 86.6% 91.2% V5 (many diffs) n/a
Download CSV