Transcript: Human NM_005282.3

Homo sapiens G protein-coupled receptor 4 (GPR4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GPR4 (2828)
Length:
3052
CDS:
950..2038

Additional Resources:

NCBI RefSeq record:
NM_005282.3
NBCI Gene record:
GPR4 (2828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357227 GGGCTGTGTTAATATTCATAA pLKO_005 2128 3UTR 100% 13.200 10.560 N GPR4 n/a
2 TRCN0000357174 CTGAAGGAGGAGATGAGTAAA pLKO_005 2244 3UTR 100% 13.200 9.240 N GPR4 n/a
3 TRCN0000011571 GTTCATCTTCTACACCAATAT pLKO.1 1231 CDS 100% 13.200 9.240 N GPR4 n/a
4 TRCN0000357175 GGTTCATCTTCTACACCAATA pLKO_005 1230 CDS 100% 10.800 7.560 N GPR4 n/a
5 TRCN0000357173 TGGCCTGGATGAACCTCTATC pLKO_005 1482 CDS 100% 10.800 7.560 N GPR4 n/a
6 TRCN0000011572 GATGAACCTCTATCGGGTGTT pLKO.1 1489 CDS 100% 4.050 2.835 N GPR4 n/a
7 TRCN0000011573 CACCAATATCTACATCAGCAT pLKO.1 1243 CDS 100% 2.640 1.848 N GPR4 n/a
8 TRCN0000011574 CTGGTCTGCTTTGCGCCCTAT pLKO.1 1649 CDS 100% 1.350 0.945 N GPR4 n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2410 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000011570 CCTCCCAAAGTGCTCAGATTA pLKO.1 2515 3UTR 100% 13.200 6.600 Y GPR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00670 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00670 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468052 GGGACTATGCGTTACCATTCATCT pLX_317 31% 100% 100% V5 n/a
4 TRCN0000489437 CCGGATTACAAACGAACAAAACAC pLX_317 30.6% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488819 AGCGTGAACCTTCTCTCTCCGGGA pLX_317 29.6% 99.9% 99.7% V5 1086_1087insG n/a
Download CSV