Construct: ORF TRCN0000468054
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017254.1_s317c1
- Derived from:
- ccsbBroadEn_12633
- DNA Barcode:
- CTCAGGGTTTGCATCCCCATCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CSPP1 (79848)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468054
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517611.3 | 57.1% | 57% | (many diffs) |
| 2 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013858.2 | 51.7% | 51.6% | (many diffs) |
| 3 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447284.1 | 48.3% | 48.2% | (many diffs) |
| 4 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001291339.1 | 43.1% | 43% | (many diffs) |
| 5 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447283.1 | 40.7% | 40.6% | (many diffs) |
| 6 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517609.2 | 40.1% | 40% | (many diffs) |
| 7 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013856.2 | 37.5% | 37.4% | (many diffs) |
| 8 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447282.1 | 36.5% | 36.4% | (many diffs) |
| 9 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013855.2 | 36.3% | 36.2% | (many diffs) |
| 10 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013854.2 | 33.8% | 33.7% | (many diffs) |
| 11 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_006716477.3 | 33.6% | 33.5% | (many diffs) |
| 12 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001363133.2 | 33.3% | 33.2% | (many diffs) |
| 13 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447281.1 | 33.3% | 33.2% | (many diffs) |
| 14 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001363132.2 | 32.5% | 32.4% | (many diffs) |
| 15 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013852.2 | 31.9% | 31.8% | (many diffs) |
| 16 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013851.2 | 31.8% | 31.8% | (many diffs) |
| 17 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001364870.1 | 31.8% | 31.7% | (many diffs) |
| 18 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001363131.2 | 31.5% | 31.4% | (many diffs) |
| 19 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447279.1 | 31.5% | 31.4% | (many diffs) |
| 20 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_024790.6 | 30.9% | 30.8% | (many diffs) |
| 21 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517607.2 | 30.8% | 30.7% | (many diffs) |
| 22 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_024447278.1 | 30.8% | 30.7% | (many diffs) |
| 23 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517603.2 | 30.6% | 30.5% | (many diffs) |
| 24 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013850.2 | 30.6% | 30.5% | (many diffs) |
| 25 | human | 79848 | CSPP1 | centrosome and spindle pole... | NM_001364869.1 | 30.2% | 30.2% | (many diffs) |
| 26 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013849.2 | 30.2% | 30.2% | (many diffs) |
| 27 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_006716474.3 | 30.2% | 30.1% | (many diffs) |
| 28 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013848.2 | 29.9% | 29.8% | (many diffs) |
| 29 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517602.2 | 29.8% | 29.7% | (many diffs) |
| 30 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_017013847.2 | 29.7% | 29.7% | (many diffs) |
| 31 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517601.2 | 29.5% | 29.4% | (many diffs) |
| 32 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517600.2 | 29.2% | 29.1% | (many diffs) |
| 33 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_005251305.4 | 29% | 28.9% | (many diffs) |
| 34 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517599.2 | 28.8% | 28.8% | (many diffs) |
| 35 | human | 79848 | CSPP1 | centrosome and spindle pole... | XM_011517598.2 | 28.7% | 28.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1203
- ORF length:
- 1137
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag acagccttct cctatagttc ctgctcttca gaacaaaatt gcaagcaaac 121 tccaaagacc tccttcagtt gacagcatca tacattcctt tattcatgaa agttccatgt 181 ccagggcaca gtcacccccg gtacctgcca ggaaaaatca gctccgtgca gaagaggaga 241 aaaaaaatgt aattatggaa ttatcagaaa tgagaaaaca gcttcgtagt gaagagaggc 301 gtctacaaga gcgattgcta cacatggaca gcgatgatga aattcctatc aggaaaaagg 361 aaaggaatcc catggatata tttgatatgg ctagacatcg gttgcaagct cctgtcagaa 421 gacagtcccc taagggctta gacgctgcca cttttcagaa tgttcatgat tttaatgagc 481 tgaaagatag agattcagaa acacgagttg atctgaaatt tatgtacctg gatcctccaa 541 gagatcatca caccttagag attcagcagc aagccctgct aagagagcag cagaagaggc 601 tgaacagaat aaaaatgcag gaaggtgcca aagttgactt agatgccatc ccaagtgcta 661 aagtacgaga gcaaagaatg cccagagatg acactagtga tttcttgaaa aactcattat 721 tggaatctga tagtgctttt attggggctt acggtgagac atatcctgcc attgaagatg 781 acgtcctccc TCCACCATCA CAGTTGCCCT CTGCACGGGA GCGCAGGAGG AACAAACGGA 841 AAGGACTAGA CATTGATAGC AGTCGTCCTA ATGTAGCACC AGATGGTCTC TCTCTAAAAT 901 CTATATCCAG TGTAAATGTT GATGAGCTTA GAGTGAGAAA TGAGGAACGA ATGCGAAGAC 961 TGAATGAATT TCACAATAAA CCTATTAATA CAGATGATGA GAGTTCACTG GTTGACCCTG 1021 ATGACATCAT GAAACACATA GGGGATGACG GATCAAACTC TGTAGCAACT GAGCCCTGGC 1081 TCCGCCCTGG CACTTCAGAA ACGCTGAAAC GTTTCATGGC AGAGCAGCTG AACCAGGAGC 1141 AGCAGCAGAT TCCTGGAAAA CCAGGCACTT TCACTTGGCA GGGCCTGTCG ACTGCACATG 1201 GTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1261 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1321 GGCTTTATAT ATCTTGTGGA AAGGACGACT CAGGGTTTGC ATCCCCATCC CCACGCGTTA 1381 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt