Transcript: Human XM_011517611.3

PREDICTED: Homo sapiens centrosome and spindle pole associated protein 1 (CSPP1), transcript variant X31, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSPP1 (79848)
Length:
4692
CDS:
297..2282

Additional Resources:

NCBI RefSeq record:
XM_011517611.3
NBCI Gene record:
CSPP1 (79848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142545 GCCATCCCAAGTGCTAAAGTA pLKO.1 1722 CDS 100% 5.625 7.875 N CSPP1 n/a
2 TRCN0000143777 GATGACGGATCAAACTCTGTA pLKO.1 2121 CDS 100% 4.950 6.930 N CSPP1 n/a
3 TRCN0000143682 GAAGGTGCCAAAGTTGACTTA pLKO.1 1698 CDS 100% 4.950 3.960 N CSPP1 n/a
4 TRCN0000143708 GTGCTAAAGTACGAGAGCAAA pLKO.1 1732 CDS 100% 4.950 3.960 N CSPP1 n/a
5 TRCN0000145004 GAAGAGGCTGAACAGAATAAA pLKO.1 1670 CDS 100% 15.000 10.500 N CSPP1 n/a
6 TRCN0000330049 TGCAATCAAATGTCCTATTAA pLKO_005 2722 3UTR 100% 15.000 10.500 N CSPP1 n/a
7 TRCN0000144637 GATTCAGAAACACGAGTTGAT pLKO.1 1569 CDS 100% 4.950 3.465 N CSPP1 n/a
8 TRCN0000143220 GAGTGAGAAATGAGGAACGAA pLKO.1 2008 CDS 100% 3.000 2.100 N CSPP1 n/a
9 TRCN0000122820 GCAAACTCCAAAGACCTCCTT pLKO.1 1192 CDS 100% 2.640 1.848 N CSPP1 n/a
10 TRCN0000142887 CCAAGAGATCATCACACCTTA pLKO.1 1614 CDS 100% 4.950 2.970 N CSPP1 n/a
11 TRCN0000330046 CCAAGAGATCATCACACCTTA pLKO_005 1614 CDS 100% 4.950 2.970 N CSPP1 n/a
12 TRCN0000121664 GATGACATCATGAAACACATA pLKO.1 2097 CDS 100% 4.950 2.970 N CSPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12633 pDONR223 100% 57.1% 57% None (many diffs) n/a
2 ccsbBroad304_12633 pLX_304 0% 57.1% 57% V5 (many diffs) n/a
3 TRCN0000468054 CTCAGGGTTTGCATCCCCATCCCC pLX_317 36.5% 57.1% 57% V5 (many diffs) n/a
Download CSV